EMAIL THIS PAGE TO A FRIEND

GABRD

gamma-aminobutyric acid (GABA) A receptor, delta

167 Gene Product Result for
Synonyms: EIG10 EJM7 GEFSP5
UniProtKB ID: O14764, Q8N4N9
Gene ID:
Human(2563) Summary: Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. The GABA-A receptor is generally pentameric and there are five types of subunits: alpha, beta, gamma, delta, and rho. This gene encodes the delta subunit. Mutations in this gene have been associated with susceptibility to generalized epilepsy with febrile seizures, type 5. Alternatively spliced transcript variants have been described for this gene, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(14403) gamma-aminobutyric acid (GABA) A receptor, subunit delta
Rat(29689) gamma-aminobutyric acid (GABA) A receptor, delta
domestic guinea pig(100735228) gamma-aminobutyric acid (GABA) A receptor, delta
naked mole-rat(101700143) gamma-aminobutyric acid (GABA) A receptor, delta
sheep(101122539) gamma-aminobutyric acid (GABA) A receptor, delta
Zebrafish(571422) gamma-aminobutyric acid (GABA) A receptor, delta
chicken(770710) gamma-aminobutyric acid (GABA) A receptor, delta
dog(489609) gamma-aminobutyric acid (GABA) A receptor, delta
cow(508711) gamma-aminobutyric acid (GABA) A receptor, delta
domestic cat(101087589) gamma-aminobutyric acid (GABA) A receptor, delta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
16730 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99.0% (GC) human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B6638 Butalbital human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C4782 Chlordiazepoxide hydrochloride drug standard, 1.0 mg/mL in methanol human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C4404 Clonazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E3638 Estazolam human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E1139 Estazolam solution drug standard, 100 μg/L in methanol human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F8763 Flunitrazepam solution drug standard, 1.0 mg/mL in methanol human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
F9134 Flurazepam dihydrochloride drug standard, 1.0 mg/mL in methanol human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
CDS019936 Isoflurane AldrichCPR human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O1755 Oxazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1503 Secobarbital analytical standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
S4006 Secobarbital solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
Y0001478 Thiopental for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D0899 Diazepam human, rat pricing
F9261 Flunitrazepam human, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
1273808 Flumazenil United States Pharmacopeia (USP) Reference Standard human pricing
F6300 Flumazenil >99% (HPLC), solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008072 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008072 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008072 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000815 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000815 Rosetta Predictions human pricing
NM_017289 Rosetta Predictions rat pricing
NM_008072 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161990 predicted 1402
2 SASI_Hs01_00161991 predicted 347
3 SASI_Hs01_00161992 predicted 1498
4 SASI_Hs01_00161993 predicted 1250
5 SASI_Hs01_00161994 predicted 651
6 SASI_Hs02_00303287 predicted 1097
7 SASI_Hs01_00161995 predicted 1391
8 SASI_Hs01_00161996 predicted 1069
9 SASI_Hs01_00161997 predicted 1127
10 SASI_Hs01_00161998 predicted 1357
11 SASI_Hs01_00161989 predicted 1614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044328 predicted 532
2 SASI_Rn02_00261727 predicted 623
3 SASI_Rn01_00044329 predicted 613
4 SASI_Rn01_00044330 predicted 1376
5 SASI_Rn01_00044331 predicted 902
6 SASI_Rn01_00044332 predicted 269
7 SASI_Rn02_00261728 predicted 274
8 SASI_Rn01_00044333 predicted 231
9 SASI_Rn01_00044334 predicted 964
10 SASI_Rn01_00044336 predicted 1384
11 SASI_Rn01_00044335 predicted 1421
12 SASI_Rn01_00044337 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008072 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071735 predicted 597
2 SASI_Mm01_00071736 predicted 671
3 SASI_Mm01_00071737 predicted 674
4 SASI_Mm01_00071739 predicted 1016
5 SASI_Mm01_00071740 predicted 317
6 SASI_Mm01_00071741 predicted 1026
7 SASI_Mm01_00071742 predicted 327
8 SASI_Mm01_00071743 predicted 1480
9 SASI_Mm02_00313061 predicted 847
10 SASI_Mm01_00071744 predicted 743
11 SASI_Mm01_00071738 predicted 1099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008072
GABRD MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, delta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008072.1-1565s1c1
Sequence:CCGGCTTGGGCTTTACCTCAACTTTCTCGAGAAAGTTGAGGTAAAGCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-1361s1c1
Sequence:CCGGGCAGACACCATCGACATCTATCTCGAGATAGATGTCGATGGTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-736s1c1
Sequence:CCGGCCAGTTCACTATCACCAGTTACTCGAGTAACTGGTGATAGTGAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-164s1c1
Sequence:CCGGGCCAGGGCAATGAATGACATTCTCGAGAATGTCATTCATTGCCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-397s1c1
Sequence:CCGGGCTGTCCTACAACCATACCAACTCGAGTTGGTATGGTTGTAGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008072
GABRD MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, delta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008072.1-1565s1c1
Sequence:CCGGCTTGGGCTTTACCTCAACTTTCTCGAGAAAGTTGAGGTAAAGCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-1361s1c1
Sequence:CCGGGCAGACACCATCGACATCTATCTCGAGATAGATGTCGATGGTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-736s1c1
Sequence:CCGGCCAGTTCACTATCACCAGTTACTCGAGTAACTGGTGATAGTGAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-164s1c1
Sequence:CCGGGCCAGGGCAATGAATGACATTCTCGAGAATGTCATTCATTGCCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-397s1c1
Sequence:CCGGGCTGTCCTACAACCATACCAACTCGAGTTGGTATGGTTGTAGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008072
GABRD MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, delta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008072.1-1565s1c1
Sequence:CCGGCTTGGGCTTTACCTCAACTTTCTCGAGAAAGTTGAGGTAAAGCCCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-1361s1c1
Sequence:CCGGGCAGACACCATCGACATCTATCTCGAGATAGATGTCGATGGTGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-736s1c1
Sequence:CCGGCCAGTTCACTATCACCAGTTACTCGAGTAACTGGTGATAGTGAACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-164s1c1
Sequence:CCGGGCCAGGGCAATGAATGACATTCTCGAGAATGTCATTCATTGCCCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008072.1-397s1c1
Sequence:CCGGGCTGTCCTACAACCATACCAACTCGAGTTGGTATGGTTGTAGGACAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000815
GABRD MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, delta
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-880s1c1
Sequence:CCGGGCTGACGATGACCACGCTCATCTCGAGATGAGCGTGGTCATCGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-91s1c1
Sequence:CCGGGATGAATGACATCGGCGACTACTCGAGTAGTCGCCGATGTCATTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-1009s1c1
Sequence:CCGGTGCTCATTTCAACGCCGACTACTCGAGTAGTCGGCGTTGAAATGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-1288s1c1
Sequence:CCGGCGCAGACACCATTGACATTTACTCGAGTAAATGTCAATGGTGTCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-574s1c1
Sequence:CCGGCGGTTACTCATCGGAGGACATCTCGAGATGTCCTCCGATGAGTAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000815
GABRD MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, delta
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-880s1c1
Sequence:CCGGGCTGACGATGACCACGCTCATCTCGAGATGAGCGTGGTCATCGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-91s1c1
Sequence:CCGGGATGAATGACATCGGCGACTACTCGAGTAGTCGCCGATGTCATTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-1009s1c1
Sequence:CCGGTGCTCATTTCAACGCCGACTACTCGAGTAGTCGGCGTTGAAATGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-1288s1c1
Sequence:CCGGCGCAGACACCATTGACATTTACTCGAGTAAATGTCAATGGTGTCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-574s1c1
Sequence:CCGGCGGTTACTCATCGGAGGACATCTCGAGATGTCCTCCGATGAGTAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000815
GABRD MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, delta
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-880s1c1
Sequence:CCGGGCTGACGATGACCACGCTCATCTCGAGATGAGCGTGGTCATCGTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-91s1c1
Sequence:CCGGGATGAATGACATCGGCGACTACTCGAGTAGTCGCCGATGTCATTCATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-1009s1c1
Sequence:CCGGTGCTCATTTCAACGCCGACTACTCGAGTAGTCGGCGTTGAAATGAGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-1288s1c1
Sequence:CCGGCGCAGACACCATTGACATTTACTCGAGTAAATGTCAATGGTGTCTGCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000815.2-574s1c1
Sequence:CCGGCGGTTACTCATCGGAGGACATCTCGAGATGTCCTCCGATGAGTAACCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???