EMAIL THIS PAGE TO A FRIEND

GABRE

gamma-aminobutyric acid (GABA) A receptor, epsilon

342 Gene Product Result for
UniProtKB ID: P78334, O15345, O15346, Q99520
Gene ID:
Human(2564) Summary: The product of this gene belongs to the ligand-gated ionic channel (TC 1.A.9) family. It encodes the gamma-aminobutyric acid (GABA) A receptor which is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes an epsilon subunit. It is mapped to chromosome Xq28 in a cluster comprised of genes encoding alpha 3, beta 4 and theta subunits of the same receptor. Alternatively spliced transcript variants have been identified, but only one is thought to encode a protein. [provided by RefSeq, Oct 2008]
Mouse(14404) gamma-aminobutyric acid (GABA) A receptor, subunit epsilon
Rat(65191) gamma-aminobutyric acid (GABA) A receptor, epsilon
chicken(396173) gamma-aminobutyric acid (GABA) A receptor, epsilon
cow(524115) gamma-aminobutyric acid (GABA) A receptor, epsilon
Horse(100069261) gamma-aminobutyric acid (GABA) A receptor, epsilon
domestic cat(101095805) gamma-aminobutyric acid (GABA) A receptor, epsilon
dog(492220) gamma-aminobutyric acid (GABA) A receptor, epsilon
sheep(101106150) gamma-aminobutyric acid (GABA) A receptor, epsilon
Domestic Rabbit(100349357) gamma-aminobutyric acid (GABA) A receptor, epsilon
naked mole-rat(101722562) gamma-aminobutyric acid (GABA) A receptor, epsilon
domestic guinea pig(100729952) gamma-aminobutyric acid (GABA) A receptor, epsilon
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA045918 Anti-GABRE antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV35342 Anti-GABRE antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB5202220 Monoclonal Anti-GABA A Receptor antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202229 Monoclonal Anti-GABA A Receptor-Alkaline Phosphatase antibody produced in mouse clone S413-67 rat, human
immunofluorescence, western blot pricing
SAB5202230 Monoclonal Anti-GABA A Receptor-Allophycocyanin antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202221 Monoclonal Anti-GABA A Receptor-Atto 390 antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202222 Monoclonal Anti-GABA A Receptor-Atto 488 antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202224 Monoclonal Anti-GABA A Receptor-Atto 594 antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202223 Monoclonal Anti-GABA A Receptor-Atto 595 antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202225 Monoclonal Anti-GABA A Receptor-Atto 633 antibody produced in mouse clone S413-67 rat, human
immunofluorescence, western blot pricing
SAB5202226 Monoclonal Anti-GABA A Receptor-Atto 655 antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202227 Monoclonal Anti-GABA A Receptor-Atto 680 antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202228 Monoclonal Anti-GABA A Receptor-Atto 700 antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202231 Monoclonal Anti-GABA A Receptor-Biotin antibody produced in mouse clone S413-67 rat, human
immunofluorescence, western blot pricing
SAB5202232 Monoclonal Anti-GABA A Receptor-FITC antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202233 Monoclonal Anti-GABA A Receptor-Horseradish Peroxidase antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202234 Monoclonal Anti-GABA A Receptor-PE/Atto 594 antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202235 Monoclonal Anti-GABA A Receptor-PerCP antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202236 Monoclonal Anti-GABA A Receptor-R-Phycoerythrin antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing
SAB5202237 Monoclonal Anti-GABA A Receptor-Streptavidin antibody produced in mouse clone S413-67 human, rat
immunofluorescence, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
16730 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99.0% (GC) human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B6638 Butalbital human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C4782 Chlordiazepoxide hydrochloride drug standard, 1.0 mg/mL in methanol human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C4404 Clonazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E3638 Estazolam human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E1139 Estazolam solution drug standard, 100 μg/L in methanol human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F8763 Flunitrazepam solution drug standard, 1.0 mg/mL in methanol human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
F9134 Flurazepam dihydrochloride drug standard, 1.0 mg/mL in methanol human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
CDS019936 Isoflurane AldrichCPR human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O1755 Oxazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1503 Secobarbital analytical standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
S4006 Secobarbital solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
Y0001478 Thiopental for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D0899 Diazepam human, rat pricing
F9261 Flunitrazepam human, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
1273808 Flumazenil United States Pharmacopeia (USP) Reference Standard human pricing
F6300 Flumazenil >99% (HPLC), solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017369 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017369 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017369 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004961 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063951 MISSION® esiRNA targeting human GABRE human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004961 Rosetta Predictions human pricing
NM_021984 Rosetta Predictions human pricing
NM_021987 Rosetta Predictions human pricing
NM_021990 Rosetta Predictions human pricing
NM_023091 Rosetta Predictions rat pricing
NM_017369 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221442 predicted 1902
2 SASI_Hs01_00221443 predicted 881
3 SASI_Hs01_00221444 predicted 1951
4 SASI_Hs01_00221445 predicted 1388
5 SASI_Hs01_00221446 predicted 824
6 SASI_Hs01_00221447 predicted 984
7 SASI_Hs01_00221448 predicted 1929
8 SASI_Hs01_00221449 predicted 1859
9 SASI_Hs01_00221450 predicted 839
10 SASI_Hs02_00338646 predicted 1539
11 SASI_Hs01_00221451 predicted 1829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076459 predicted 2074
2 SASI_Hs01_00076460 predicted 1056
3 SASI_Hs01_00076461 predicted 2138
4 SASI_Hs01_00076462 predicted 1562
5 SASI_Hs01_00076463 predicted 1007
6 SASI_Hs01_00076464 predicted 1166
7 SASI_Hs01_00076465 predicted 2105
8 SASI_Hs01_00076466 predicted 2032
9 SASI_Hs01_00076467 predicted 1016
10 SASI_Hs02_00355355 predicted 1715
11 SASI_Hs01_00076468 predicted 2010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055022 predicted 1980
2 SASI_Hs01_00055023 predicted 966
3 SASI_Hs01_00055024 predicted 2040
4 SASI_Hs01_00055025 predicted 1474
5 SASI_Hs01_00055026 predicted 908
6 SASI_Hs01_00055027 predicted 1069
7 SASI_Hs01_00055028 predicted 2008
8 SASI_Hs01_00055029 predicted 1942
9 SASI_Hs01_00055030 predicted 921
10 SASI_Hs02_00355356 predicted 1615
11 SASI_Hs01_00055031 predicted 1916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065220 predicted 2808
2 SASI_Hs01_00065221 predicted 1794
3 SASI_Hs01_00065222 predicted 2871
4 SASI_Hs01_00065223 predicted 2306
5 SASI_Hs01_00065224 predicted 1740
6 SASI_Hs01_00065225 predicted 1897
7 SASI_Hs01_00065226 predicted 2843
8 SASI_Hs01_00065227 predicted 2767
9 SASI_Hs01_00065228 predicted 1747
10 SASI_Hs02_00355357 predicted 2448
11 SASI_Hs01_00065229 predicted 2743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023091 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071318 predicted 2182
2 SASI_Rn01_00071319 predicted 2020
3 SASI_Rn01_00071320 predicted 1785
4 SASI_Rn01_00071321 predicted 1882
5 SASI_Rn01_00071322 predicted 1776
6 SASI_Rn01_00071323 predicted 2269
7 SASI_Rn01_00071324 predicted 2046
8 SASI_Rn01_00071325 predicted 1760
9 SASI_Rn01_00071326 predicted 1841
10 SASI_Rn01_00071327 predicted 1908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023769 predicted 2273
2 SASI_Mm01_00023771 predicted 2218
3 SASI_Mm01_00023772 predicted 2523
4 SASI_Mm02_00323847 predicted 2365
5 SASI_Mm01_00023773 predicted 1801
6 SASI_Mm01_00023774 predicted 1957
7 SASI_Mm01_00023776 predicted 1787
8 SASI_Mm01_00023775 predicted 2389
9 SASI_Mm01_00023777 predicted 1799
10 SASI_Mm01_00023778 predicted 1624
11 SASI_Mm01_00023770 predicted 1637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017369
GABRE MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, epsilon
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-241s1c1
Sequence:CCGGGCCATGATGATGTAGTCTTTACTCGAGTAAAGACTACATCATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-1475s1c1
Sequence:CCGGCCTGAGCAACTATGACCATAACTCGAGTTATGGTCATAGTTGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-84s1c1
Sequence:CCGGCCTCATGTTAATCTGGAGAATCTCGAGATTCTCCAGATTAACATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-2382s1c1
Sequence:CCGGCCAACCAATAGCCGTGCTAATCTCGAGATTAGCACGGCTATTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-1476s1c1
Sequence:CCGGCTGAGCAACTATGACCATAAACTCGAGTTTATGGTCATAGTTGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017369
GABRE MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, epsilon
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-241s1c1
Sequence:CCGGGCCATGATGATGTAGTCTTTACTCGAGTAAAGACTACATCATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-1475s1c1
Sequence:CCGGCCTGAGCAACTATGACCATAACTCGAGTTATGGTCATAGTTGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-84s1c1
Sequence:CCGGCCTCATGTTAATCTGGAGAATCTCGAGATTCTCCAGATTAACATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-2382s1c1
Sequence:CCGGCCAACCAATAGCCGTGCTAATCTCGAGATTAGCACGGCTATTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-1476s1c1
Sequence:CCGGCTGAGCAACTATGACCATAAACTCGAGTTTATGGTCATAGTTGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017369
GABRE MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, epsilon
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-241s1c1
Sequence:CCGGGCCATGATGATGTAGTCTTTACTCGAGTAAAGACTACATCATCATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-1475s1c1
Sequence:CCGGCCTGAGCAACTATGACCATAACTCGAGTTATGGTCATAGTTGCTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-84s1c1
Sequence:CCGGCCTCATGTTAATCTGGAGAATCTCGAGATTCTCCAGATTAACATGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-2382s1c1
Sequence:CCGGCCAACCAATAGCCGTGCTAATCTCGAGATTAGCACGGCTATTGGTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017369.1-1476s1c1
Sequence:CCGGCTGAGCAACTATGACCATAAACTCGAGTTTATGGTCATAGTTGCTCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004961
GABRE MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, epsilon
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-288s1c1
Sequence:CCGGCCTGAGTAATTATGACCACAACTCGAGTTGTGGTCATAATTACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-682s1c1
Sequence:CCGGCCTCTATCTTTCTCTAGCTTTCTCGAGAAAGCTAGAGAAAGATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-1518s1c1
Sequence:CCGGCCCAGTGACTTTCTTCTTCTTCTCGAGAAGAAGAAGAAAGTCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-747s1c1
Sequence:CCGGGCTTGAAATCAATGAGAAGAACTCGAGTTCTTCTCATTGATTTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-444s1c1
Sequence:CCGGCCTCTGTTACAACGACACCTTCTCGAGAAGGTGTCGTTGTAACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004961
GABRE MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, epsilon
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-288s1c1
Sequence:CCGGCCTGAGTAATTATGACCACAACTCGAGTTGTGGTCATAATTACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-682s1c1
Sequence:CCGGCCTCTATCTTTCTCTAGCTTTCTCGAGAAAGCTAGAGAAAGATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-1518s1c1
Sequence:CCGGCCCAGTGACTTTCTTCTTCTTCTCGAGAAGAAGAAGAAAGTCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-747s1c1
Sequence:CCGGGCTTGAAATCAATGAGAAGAACTCGAGTTCTTCTCATTGATTTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-444s1c1
Sequence:CCGGCCTCTGTTACAACGACACCTTCTCGAGAAGGTGTCGTTGTAACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004961
GABRE MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, epsilon
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-288s1c1
Sequence:CCGGCCTGAGTAATTATGACCACAACTCGAGTTGTGGTCATAATTACTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-682s1c1
Sequence:CCGGCCTCTATCTTTCTCTAGCTTTCTCGAGAAAGCTAGAGAAAGATAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061619    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-1518s1c1
Sequence:CCGGCCCAGTGACTTTCTTCTTCTTCTCGAGAAGAAGAAGAAAGTCACTGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-747s1c1
Sequence:CCGGGCTTGAAATCAATGAGAAGAACTCGAGTTCTTCTCATTGATTTCAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000061620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004961.2-444s1c1
Sequence:CCGGCCTCTGTTACAACGACACCTTCTCGAGAAGGTGTCGTTGTAACAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???