EMAIL THIS PAGE TO A FRIEND

GABRG1

gamma-aminobutyric acid (GABA) A receptor, gamma 1

195 Gene Product Result for
UniProtKB ID: Q8N1C3, Q5H9T8
Gene ID:
Human(2565) Summary: The protein encoded by this gene belongs to the ligand-gated ionic channel family. It is an integral membrane protein and plays an important role in inhibiting neurotransmission by binding to the benzodiazepine receptor and opening an integral chloride channel. This gene is clustered with three other family members on chromosome 4. [provided by RefSeq, Jul 2008]
Mouse(14405) gamma-aminobutyric acid (GABA) A receptor, subunit gamma 1
Rat(140674) gamma-aminobutyric acid (GABA) A receptor, gamma 1
domestic guinea pig(100718407) gamma-aminobutyric acid (GABA) A receptor, gamma 1
naked mole-rat(101721607) gamma-aminobutyric acid (GABA) A receptor, gamma 1
sheep(101121012) gamma-aminobutyric acid (GABA) A receptor, gamma 1
chicken(422771) gamma-aminobutyric acid (GABA) A receptor, gamma 1
domestic cat(101099123) gamma-aminobutyric acid (GABA) A receptor, gamma 1
cow(615885) gamma-aminobutyric acid (GABA) A receptor, gamma 1
dog(482130) gamma-aminobutyric acid (GABA) A receptor, gamma 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
16730 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99.0% (GC) human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B6638 Butalbital human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C4782 Chlordiazepoxide hydrochloride drug standard, 1.0 mg/mL in methanol human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C4404 Clonazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E3638 Estazolam human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E1139 Estazolam solution drug standard, 100 μg/L in methanol human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F8763 Flunitrazepam solution drug standard, 1.0 mg/mL in methanol human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
F9134 Flurazepam dihydrochloride drug standard, 1.0 mg/mL in methanol human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
CDS019936 Isoflurane AldrichCPR human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O1755 Oxazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1503 Secobarbital analytical standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
S4006 Secobarbital solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
Y0001478 Thiopental for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D0899 Diazepam human, rat pricing
F9261 Flunitrazepam human, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A3539 3-Amino-2,3-dihydrobenzoic acid hydrochloride ≥98% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173536 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173536 Rosetta Predictions human pricing
NM_080586 Rosetta Predictions rat pricing
NM_010252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140791 predicted 707
2 SASI_Hs01_00140792 predicted 414
3 SASI_Hs01_00140793 predicted 678
4 SASI_Hs01_00140794 predicted 692
5 SASI_Hs01_00140795 predicted 529
6 SASI_Hs01_00140796 predicted 436
7 SASI_Hs01_00140797 predicted 445
8 SASI_Hs01_00140798 predicted 1519
9 SASI_Hs01_00140799 predicted 360
10 SASI_Hs01_00140800 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032284 predicted 711
2 SASI_Rn01_00032285 predicted 355
3 SASI_Rn01_00032286 predicted 1476
4 SASI_Rn02_00267261 predicted 1487
5 SASI_Rn01_00032287 predicted 1038
6 SASI_Rn01_00032288 predicted 778
7 SASI_Rn01_00032289 predicted 645
8 SASI_Rn01_00032290 predicted 636
9 SASI_Rn01_00032292 predicted 1144
10 SASI_Rn01_00032293 predicted 820
11 SASI_Rn01_00032291 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109477 predicted 1427
2 SASI_Mm02_00318143 predicted 783
3 SASI_Mm01_00109478 predicted 922
4 SASI_Mm01_00109479 predicted 620
5 SASI_Mm01_00109481 predicted 777
6 SASI_Mm01_00109482 predicted 1589
7 SASI_Mm01_00109483 predicted 720
8 SASI_Mm02_00318144 predicted 717
9 SASI_Mm01_00109484 predicted 937
10 SASI_Mm01_00109485 predicted 580
11 SASI_Mm01_00109476 predicted 1847
12 SASI_Mm01_00109480 predicted 665
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010252
GABRG1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, gamma 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-1344s1c1
Sequence:CCGGCCTCAGTACAATTGCTAGAAACTCGAGTTTCTAGCAATTGTACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-460s1c1
Sequence:CCGGGTGAGGTTGATATTCTTGTTACTCGAGTAACAAGAATATCAACCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010252.3-4440s1c1
Sequence:CCGGCCGATTTACAAGACCAGGATTCTCGAGAATCCTGGTCTTGTAAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-955s1c1
Sequence:CCGGGCAGAGTGCTACCTTCAACTTCTCGAGAAGTTGAAGGTAGCACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-752s1c1
Sequence:CCGGCCTGGTTTGACAGCCGTTTAACTCGAGTTAAACGGCTGTCAAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-719s21c1
Sequence:CCGGGGAGTATACAATAGACATAATCTCGAGATTATGTCTATTGTATACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-1448s21c1
Sequence:CCGGATACGGAACCTTGCATTATTTCTCGAGAAATAATGCAAGGTTCCGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-890s21c1
Sequence:CCGGTAATCGCCTGCTGCGGATTTGCTCGAGCAAATCCGCAGCAGGCGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-1769s21c1
Sequence:CCGGTTACTGGGTTGGGTATCTATACTCGAGTATAGATACCCAACCCAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010252
GABRG1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, gamma 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-1344s1c1
Sequence:CCGGCCTCAGTACAATTGCTAGAAACTCGAGTTTCTAGCAATTGTACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-460s1c1
Sequence:CCGGGTGAGGTTGATATTCTTGTTACTCGAGTAACAAGAATATCAACCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010252.3-4440s1c1
Sequence:CCGGCCGATTTACAAGACCAGGATTCTCGAGAATCCTGGTCTTGTAAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-955s1c1
Sequence:CCGGGCAGAGTGCTACCTTCAACTTCTCGAGAAGTTGAAGGTAGCACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-752s1c1
Sequence:CCGGCCTGGTTTGACAGCCGTTTAACTCGAGTTAAACGGCTGTCAAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-719s21c1
Sequence:CCGGGGAGTATACAATAGACATAATCTCGAGATTATGTCTATTGTATACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-1448s21c1
Sequence:CCGGATACGGAACCTTGCATTATTTCTCGAGAAATAATGCAAGGTTCCGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-890s21c1
Sequence:CCGGTAATCGCCTGCTGCGGATTTGCTCGAGCAAATCCGCAGCAGGCGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-1769s21c1
Sequence:CCGGTTACTGGGTTGGGTATCTATACTCGAGTATAGATACCCAACCCAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010252
GABRG1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, gamma 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-1344s1c1
Sequence:CCGGCCTCAGTACAATTGCTAGAAACTCGAGTTTCTAGCAATTGTACTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000088967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-460s1c1
Sequence:CCGGGTGAGGTTGATATTCTTGTTACTCGAGTAACAAGAATATCAACCTCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000088963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010252.3-4440s1c1
Sequence:CCGGCCGATTTACAAGACCAGGATTCTCGAGAATCCTGGTCTTGTAAATCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000088965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-955s1c1
Sequence:CCGGGCAGAGTGCTACCTTCAACTTCTCGAGAAGTTGAAGGTAGCACTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000088966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010252.3-752s1c1
Sequence:CCGGCCTGGTTTGACAGCCGTTTAACTCGAGTTAAACGGCTGTCAAACCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000436038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-719s21c1
Sequence:CCGGGGAGTATACAATAGACATAATCTCGAGATTATGTCTATTGTATACTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-1448s21c1
Sequence:CCGGATACGGAACCTTGCATTATTTCTCGAGAAATAATGCAAGGTTCCGTATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000415974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-890s21c1
Sequence:CCGGTAATCGCCTGCTGCGGATTTGCTCGAGCAAATCCGCAGCAGGCGATTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000431817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010252.4-1769s21c1
Sequence:CCGGTTACTGGGTTGGGTATCTATACTCGAGTATAGATACCCAACCCAGTAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173536
GABRG1 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, gamma 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000435248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173536.3-548s21c1
Sequence:CCGGGCTTATGCTTAACAGTAATATCTCGAGATATTACTGTTAAGCATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173536.3-644s21c1
Sequence:CCGGTAATCGTCTGCTTCGAATTTGCTCGAGCAAATTCGAAGCAGACGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173536
GABRG1 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, gamma 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000435248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173536.3-548s21c1
Sequence:CCGGGCTTATGCTTAACAGTAATATCTCGAGATATTACTGTTAAGCATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173536.3-644s21c1
Sequence:CCGGTAATCGTCTGCTTCGAATTTGCTCGAGCAAATTCGAAGCAGACGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173536
GABRG1 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, gamma 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000435248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173536.3-548s21c1
Sequence:CCGGGCTTATGCTTAACAGTAATATCTCGAGATATTACTGTTAAGCATAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000430962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173536.3-644s21c1
Sequence:CCGGTAATCGTCTGCTTCGAATTTGCTCGAGCAAATTCGAAGCAGACGATTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???