EMAIL THIS PAGE TO A FRIEND

GABRG2

gamma-aminobutyric acid (GABA) A receptor, gamma 2

358 Gene Product Result for
Synonyms: CAE2 ECA2 GEFSP3
UniProtKB ID: P18507, F5HB82, Q6GRL6, Q6PCC3, Q9UDB3, Q9UN15
Gene ID:
Human(2566) Summary: This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammlian brain, where it acts at GABA-A receptors, which are ligand-gated chloride channels. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. Mutations in this gene have been associated with epilepsy and febrile seizures. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(14406) gamma-aminobutyric acid (GABA) A receptor, subunit gamma 2
Rat(29709) gamma-aminobutyric acid (GABA) A receptor, gamma 2
Zebrafish(553402) gamma-aminobutyric acid (GABA) A receptor, gamma 2
chicken(396289) gamma-aminobutyric acid (GABA) A receptor, gamma 2
cow(282240) gamma-aminobutyric acid (GABA) A receptor, gamma 2
domestic cat(100286791) gamma-aminobutyric acid (GABA) A receptor, gamma 2
Horse(100059571) gamma-aminobutyric acid (GABA) A receptor, gamma 2
dog(489141) gamma-aminobutyric acid (GABA) A receptor, gamma 2
sheep(101118526) gamma-aminobutyric acid (GABA) A receptor, gamma 2
naked mole-rat(101718598) gamma-aminobutyric acid (GABA) A receptor, gamma 2
domestic guinea pig(100723005) gamma-aminobutyric acid (GABA) A receptor, gamma 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
16730 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99.0% (GC) human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
P5052 5α-Pregnan-3α-ol-11,20-dione powder, ≥98% (TLC) human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B6638 Butalbital human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C4782 Chlordiazepoxide hydrochloride drug standard, 1.0 mg/mL in methanol human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C4404 Clonazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E3638 Estazolam human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E1139 Estazolam solution drug standard, 100 μg/L in methanol human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F8763 Flunitrazepam solution drug standard, 1.0 mg/mL in methanol human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F9134 Flurazepam dihydrochloride drug standard, 1.0 mg/mL in methanol human pricing
F103 Flurazepam dihydrochloride solid human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
CDS019936 Isoflurane AldrichCPR human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O1755 Oxazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
S1503 Secobarbital analytical standard human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
S4006 Secobarbital solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
Y0001478 Thiopental for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T9772 Triazolam human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1724350 Zaleplon United States Pharmacopeia (USP) Reference Standard human pricing
Z0502 Zaleplon ≥98% (HPLC), solid human pricing
Z-004 Zaleplon solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
Y0002139 Zolpidem for system suitability CRS, European Pharmacopoeia (EP) Reference Standard human pricing
Z-017 Zolpidem solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D0899 Diazepam human, rat pricing
F9261 Flunitrazepam human, rat pricing
Z103 Zolpidem ≥98% (HPLC), solid human, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A3539 3-Amino-2,3-dihydrobenzoic acid hydrochloride ≥98% human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing
E5126 Etiocholan-3α-ol-17-one human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000816 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083141 MISSION® esiRNA esiRNA human GABRG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000816 Rosetta Predictions human pricing
NM_198903 Rosetta Predictions human pricing
NM_198904 Rosetta Predictions human pricing
NM_183327 Rosetta Predictions rat pricing
NM_008073 Rosetta Predictions mouse pricing
NM_177408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303288 predicted 663
2 SASI_Hs01_00201787 predicted 1818
3 SASI_Hs01_00201790 predicted 1770
4 SASI_Hs01_00201792 predicted 1789
5 SASI_Hs02_00303289 predicted 622
6 SASI_Hs01_00201793 predicted 1813
7 SASI_Hs01_00201794 predicted 1710
8 SASI_Hs02_00303290 predicted 635
9 SASI_Hs01_00201796 predicted 1823
10 SASI_Hs02_00303291 predicted 1810
11 SASI_Hs01_00201788 predicted 1043
12 SASI_Hs01_00201789 predicted 1787
13 SASI_Hs01_00201791 predicted 1027
14 SASI_Hs01_00201795 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372401 predicted 665
2 SASI_Hs01_00034640 predicted 1960
3 SASI_Hs01_00034643 predicted 1914
4 SASI_Hs01_00034645 predicted 1932
5 SASI_Hs02_00372402 predicted 617
6 SASI_Hs01_00034646 predicted 1948
7 SASI_Hs01_00034647 predicted 1863
8 SASI_Hs02_00372403 predicted 636
9 SASI_Hs01_00034649 predicted 1969
10 SASI_Hs02_00372404 predicted 1958
11 SASI_Hs01_00034641 predicted 984
12 SASI_Hs01_00034642 predicted 1717
13 SASI_Hs01_00034644 predicted 965
14 SASI_Hs01_00034648 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198904 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372405 predicted 661
2 SASI_Hs01_00198579 predicted 1842
3 SASI_Hs01_00198582 predicted 1796
4 SASI_Hs01_00198584 predicted 1806
5 SASI_Hs02_00372406 predicted 616
6 SASI_Hs01_00198585 predicted 1835
7 SASI_Hs01_00198586 predicted 1739
8 SASI_Hs02_00372407 predicted 633
9 SASI_Hs01_00198588 predicted 1849
10 SASI_Hs02_00372408 predicted 1831
11 SASI_Hs01_00198580 predicted 1053
12 SASI_Hs01_00198581 predicted 1811
13 SASI_Hs01_00198583 predicted 1025
14 SASI_Hs01_00198587 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112488 predicted 769
2 SASI_Rn02_00269877 predicted 784
3 SASI_Rn01_00112490 predicted 1139
4 SASI_Rn01_00112491 predicted 668
5 SASI_Rn02_00269878 predicted 1007
6 SASI_Rn02_00269879 predicted 633
7 SASI_Rn01_00112492 predicted 621
8 SASI_Rn01_00112494 predicted 986
9 SASI_Rn01_00112495 predicted 611
10 SASI_Rn01_00112496 predicted 752
11 SASI_Rn01_00112487 predicted 731
12 SASI_Rn01_00112489 predicted 953
13 SASI_Rn01_00112493 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313062 predicted 1079
2 SASI_Mm02_00313063 predicted 1793
3 SASI_Mm01_00041788 predicted 1761
4 SASI_Mm01_00041789 predicted 1829
5 SASI_Mm02_00313064 predicted 1133
6 SASI_Mm02_00313065 predicted 1750
7 SASI_Mm02_00313066 predicted 1099
8 SASI_Mm01_00041795 predicted 1736
9 SASI_Mm02_00313067 predicted 1014
10 SASI_Mm02_00313068 predicted 892
11 SASI_Mm01_00041786 predicted 1932
12 SASI_Mm01_00041787 predicted 1881
13 SASI_Mm01_00041790 predicted 1942
14 SASI_Mm01_00041791 predicted 909
15 SASI_Mm01_00041792 predicted 1882
16 SASI_Mm01_00041793 predicted 916
17 SASI_Mm01_00041794 predicted 1893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347608 predicted 716
2 SASI_Mm02_00347609 predicted 1414
3 SASI_Mm01_00123064 predicted 1378
4 SASI_Mm01_00123065 predicted 1442
5 SASI_Mm02_00347610 predicted 768
6 SASI_Mm02_00347611 predicted 1363
7 SASI_Mm02_00347612 predicted 737
8 SASI_Mm01_00123071 predicted 1354
9 SASI_Mm02_00347613 predicted 651
10 SASI_Mm02_00347614 predicted 533
11 SASI_Mm01_00123062 predicted 1550
12 SASI_Mm01_00123063 predicted 1503
13 SASI_Mm01_00123066 predicted 1553
14 SASI_Mm01_00123067 predicted 557
15 SASI_Mm01_00123068 predicted 1503
16 SASI_Mm01_00123069 predicted 562
17 SASI_Mm01_00123070 predicted 1514
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000816
GABRG2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, gamma 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000816.3-2080s21c1
Sequence:CCGGGTATCCTTACTAGATTCATAACTCGAGTTATGAATCTAGTAAGGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000816.3-1877s21c1
Sequence:CCGGCTATGTCCAAACCTGGTAAATCTCGAGATTTACCAGGTTTGGACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000816.3-1645s21c1
Sequence:CCGGGAGACATGGGAGGATACATATCTCGAGATATGTATCCTCCCATGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000816.3-614s21c1
Sequence:CCGGGGAGTGAAGCCAACGTTAATTCTCGAGAATTAACGTTGGCTTCACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1650s1c1
Sequence:CCGGGCCTGTTTAATCTGGTCTATTCTCGAGAATAGACCAGATTAAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-691s1c1
Sequence:CCGGCCTCCGATTGAACAGCAACATCTCGAGATGTTGCTGTTCAATCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1032s1c1
Sequence:CCGGCCACCGAAGTAGTGAAGACAACTCGAGTTGTCTTCACTACTTCGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000048249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1137s1c1
Sequence:CCGGGCACACTCATTGTCGTCCTATCTCGAGATAGGACGACAATGAGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000816
GABRG2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, gamma 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000816.3-2080s21c1
Sequence:CCGGGTATCCTTACTAGATTCATAACTCGAGTTATGAATCTAGTAAGGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000816.3-1877s21c1
Sequence:CCGGCTATGTCCAAACCTGGTAAATCTCGAGATTTACCAGGTTTGGACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000816.3-1645s21c1
Sequence:CCGGGAGACATGGGAGGATACATATCTCGAGATATGTATCCTCCCATGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000816.3-614s21c1
Sequence:CCGGGGAGTGAAGCCAACGTTAATTCTCGAGAATTAACGTTGGCTTCACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1650s1c1
Sequence:CCGGGCCTGTTTAATCTGGTCTATTCTCGAGAATAGACCAGATTAAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-691s1c1
Sequence:CCGGCCTCCGATTGAACAGCAACATCTCGAGATGTTGCTGTTCAATCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1032s1c1
Sequence:CCGGCCACCGAAGTAGTGAAGACAACTCGAGTTGTCTTCACTACTTCGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000048249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1137s1c1
Sequence:CCGGGCACACTCATTGTCGTCCTATCTCGAGATAGGACGACAATGAGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000816
GABRG2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, gamma 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000816.3-2080s21c1
Sequence:CCGGGTATCCTTACTAGATTCATAACTCGAGTTATGAATCTAGTAAGGATACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000413219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000816.3-1877s21c1
Sequence:CCGGCTATGTCCAAACCTGGTAAATCTCGAGATTTACCAGGTTTGGACATAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000434007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000816.3-1645s21c1
Sequence:CCGGGAGACATGGGAGGATACATATCTCGAGATATGTATCCTCCCATGTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000816.3-614s21c1
Sequence:CCGGGGAGTGAAGCCAACGTTAATTCTCGAGAATTAACGTTGGCTTCACTCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1650s1c1
Sequence:CCGGGCCTGTTTAATCTGGTCTATTCTCGAGAATAGACCAGATTAAACAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-691s1c1
Sequence:CCGGCCTCCGATTGAACAGCAACATCTCGAGATGTTGCTGTTCAATCGGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1032s1c1
Sequence:CCGGCCACCGAAGTAGTGAAGACAACTCGAGTTGTCTTCACTACTTCGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000048249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000816.2-1137s1c1
Sequence:CCGGGCACACTCATTGTCGTCCTATCTCGAGATAGGACGACAATGAGTGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008073
GABRG2 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, gamma 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-1527s1c1
Sequence:CCGGGCAACCATTCAAATGAACAATCTCGAGATTGTTCATTTGAATGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-984s1c1
Sequence:CCGGCCTCGTGAAGAAATTGTTTATCTCGAGATAAACAATTTCTTCACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-1520s1c1
Sequence:CCGGCAGATCAGCAACCATTCAAATCTCGAGATTTGAATGGTTGCTGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008073.1-1932s1c1
Sequence:CCGGCCGTGGTTATTGTAATTTGAACTCGAGTTCAAATTACAATAACCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-479s1c1
Sequence:CCGGCTATGAAGATTACGCTTCTAACTCGAGTTAGAAGCGTAATCTTCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008073
GABRG2 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, gamma 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-1527s1c1
Sequence:CCGGGCAACCATTCAAATGAACAATCTCGAGATTGTTCATTTGAATGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-984s1c1
Sequence:CCGGCCTCGTGAAGAAATTGTTTATCTCGAGATAAACAATTTCTTCACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-1520s1c1
Sequence:CCGGCAGATCAGCAACCATTCAAATCTCGAGATTTGAATGGTTGCTGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008073.1-1932s1c1
Sequence:CCGGCCGTGGTTATTGTAATTTGAACTCGAGTTCAAATTACAATAACCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-479s1c1
Sequence:CCGGCTATGAAGATTACGCTTCTAACTCGAGTTAGAAGCGTAATCTTCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008073
GABRG2 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, gamma 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-1527s1c1
Sequence:CCGGGCAACCATTCAAATGAACAATCTCGAGATTGTTCATTTGAATGGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-984s1c1
Sequence:CCGGCCTCGTGAAGAAATTGTTTATCTCGAGATAAACAATTTCTTCACGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-1520s1c1
Sequence:CCGGCAGATCAGCAACCATTCAAATCTCGAGATTTGAATGGTTGCTGATCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008073.1-1932s1c1
Sequence:CCGGCCGTGGTTATTGTAATTTGAACTCGAGTTCAAATTACAATAACCACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000089095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008073.1-479s1c1
Sequence:CCGGCTATGAAGATTACGCTTCTAACTCGAGTTAGAAGCGTAATCTTCATAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???