EMAIL THIS PAGE TO A FRIEND

GABRG3

gamma-aminobutyric acid (GABA) A receptor, gamma 3

162 Gene Product Result for
UniProtKB ID: Q99928, G3V594, Q9HD46, Q9NYT2
Gene ID:
Human(2567) Summary: This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. The protein encoded by this gene is a gamma subunit, which contains the benzodiazepine binding site. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
Mouse(14407) gamma-aminobutyric acid (GABA) A receptor, subunit gamma 3
Rat(79211) gamma-aminobutyric acid (GABA) A receptor, gamma 3
domestic guinea pig(100729690) gamma-aminobutyric acid (GABA) A receptor, gamma 3
naked mole-rat(101712623) gamma-aminobutyric acid (GABA) A receptor, gamma 3
sheep(101108521) gamma-aminobutyric acid (GABA) A receptor, gamma 3
Zebrafish(567057) gamma-aminobutyric acid (GABA) A receptor, gamma 3
cow(613670) gamma-aminobutyric acid (GABA) A receptor, gamma 3
domestic cat(101094182) gamma-aminobutyric acid (GABA) A receptor, gamma 3
dog(488685) gamma-aminobutyric acid (GABA) A receptor, gamma 3
chicken(770097) gamma-aminobutyric acid (GABA) A receptor, gamma 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
16730 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99.0% (GC) human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B6638 Butalbital human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C4782 Chlordiazepoxide hydrochloride drug standard, 1.0 mg/mL in methanol human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C4404 Clonazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E3638 Estazolam human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E1139 Estazolam solution drug standard, 100 μg/L in methanol human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F8763 Flunitrazepam solution drug standard, 1.0 mg/mL in methanol human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
F9134 Flurazepam dihydrochloride drug standard, 1.0 mg/mL in methanol human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
CDS019936 Isoflurane AldrichCPR human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O1755 Oxazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1503 Secobarbital analytical standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
S4006 Secobarbital solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
Y0001478 Thiopental for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D0899 Diazepam human, rat pricing
F9261 Flunitrazepam human, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
1273808 Flumazenil United States Pharmacopeia (USP) Reference Standard human pricing
F6300 Flumazenil >99% (HPLC), solid human, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A3539 3-Amino-2,3-dihydrobenzoic acid hydrochloride ≥98% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033223 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008074 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008074 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008074 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023001 MISSION® esiRNA esiRNA human GABRG3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033223 Rosetta Predictions human pricing
NM_024370 Rosetta Predictions rat pricing
NM_008074 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144147 predicted 404
2 SASI_Hs01_00144148 predicted 1171
3 SASI_Hs01_00144149 predicted 802
4 SASI_Hs01_00144150 predicted 1010
5 SASI_Hs01_00144152 predicted 949
6 SASI_Hs02_00361020 predicted 1215
7 SASI_Hs01_00144153 predicted 601
8 SASI_Hs01_00144154 predicted 467
9 SASI_Hs02_00361021 predicted 1282
10 SASI_Hs02_00361022 predicted 320
11 SASI_Hs01_00144151 predicted 1227
12 SASI_Hs01_00144155 predicted 1301
13 SASI_Hs01_00144156 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087306 predicted 248
2 SASI_Rn01_00087307 predicted 470
3 SASI_Rn01_00087308 predicted 675
4 SASI_Rn01_00087309 predicted 814
5 SASI_Rn01_00087310 predicted 377
6 SASI_Rn01_00087311 predicted 754
7 SASI_Rn01_00087312 predicted 962
8 SASI_Rn01_00087313 predicted 438
9 SASI_Rn01_00087314 predicted 336
10 SASI_Rn01_00087315 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008074 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168653 predicted 1198
2 SASI_Mm01_00168655 predicted 1274
3 SASI_Mm01_00168656 predicted 732
4 SASI_Mm01_00168657 predicted 947
5 SASI_Mm01_00168658 predicted 1285
6 SASI_Mm01_00168659 predicted 456
7 SASI_Mm01_00168660 predicted 1104
8 SASI_Mm02_00313069 predicted 407
9 SASI_Mm01_00168661 predicted 314
10 SASI_Mm02_00313070 predicted 582
11 SASI_Mm01_00168652 predicted 1148
12 SASI_Mm01_00168654 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033223
GABRG3 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, gamma 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-170s1c1
Sequence:CCGGCGTGACTCTTATTCTCAACAACTCGAGTTGTTGAGAATAAGAGTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-668s1c1
Sequence:CCGGCCAGAAATCATGGCGGCTTTACTCGAGTAAAGCCGCCATGATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-1125s1c1
Sequence:CCGGCCTGAGCGAATAAGCCTACAACTCGAGTTGTAGGCTTATTCGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-1288s1c1
Sequence:CCGGGCTGCTATGAAGAATGTAAATCTCGAGATTTACATTCTTCATAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-350s1c1
Sequence:CCGGCCTTCGATTCAACAGCACAATCTCGAGATTGTGCTGTTGAATCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033223.4-468s21c1
Sequence:CCGGGTAATTGACGTTGACATTTATCTCGAGATAAATGTCAACGTCAATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033223.4-955s21c1
Sequence:CCGGCAACGTCTGCAGGTGATTATGCTCGAGCATAATCACCTGCAGACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033223
GABRG3 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, gamma 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-170s1c1
Sequence:CCGGCGTGACTCTTATTCTCAACAACTCGAGTTGTTGAGAATAAGAGTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-668s1c1
Sequence:CCGGCCAGAAATCATGGCGGCTTTACTCGAGTAAAGCCGCCATGATTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-1125s1c1
Sequence:CCGGCCTGAGCGAATAAGCCTACAACTCGAGTTGTAGGCTTATTCGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-1288s1c1
Sequence:CCGGGCTGCTATGAAGAATGTAAATCTCGAGATTTACATTCTTCATAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-350s1c1
Sequence:CCGGCCTTCGATTCAACAGCACAATCTCGAGATTGTGCTGTTGAATCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033223.4-468s21c1
Sequence:CCGGGTAATTGACGTTGACATTTATCTCGAGATAAATGTCAACGTCAATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033223.4-955s21c1
Sequence:CCGGCAACGTCTGCAGGTGATTATGCTCGAGCATAATCACCTGCAGACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033223
GABRG3 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, gamma 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-170s1c1
Sequence:CCGGCGTGACTCTTATTCTCAACAACTCGAGTTGTTGAGAATAAGAGTCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-668s1c1
Sequence:CCGGCCAGAAATCATGGCGGCTTTACTCGAGTAAAGCCGCCATGATTTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-1125s1c1
Sequence:CCGGCCTGAGCGAATAAGCCTACAACTCGAGTTGTAGGCTTATTCGCTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-1288s1c1
Sequence:CCGGGCTGCTATGAAGAATGTAAATCTCGAGATTTACATTCTTCATAGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033223.1-350s1c1
Sequence:CCGGCCTTCGATTCAACAGCACAATCTCGAGATTGTGCTGTTGAATCGAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000428409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033223.4-468s21c1
Sequence:CCGGGTAATTGACGTTGACATTTATCTCGAGATAAATGTCAACGTCAATTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000419361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033223.4-955s21c1
Sequence:CCGGCAACGTCTGCAGGTGATTATGCTCGAGCATAATCACCTGCAGACGTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008074
GABRG3 MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, gamma 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008074.1-1441s1c1
Sequence:CCGGCTGAGGGATGACTGAAGAGTACTCGAGTACTCTTCAGTCATCCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1134s1c1
Sequence:CCGGGCCTTCAAGCACCCTCTAATTCTCGAGAATTAGAGGGTGCTTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-676s1c1
Sequence:CCGGGCGGCTCTATCAGTTTGACTTCTCGAGAAGTCAAACTGATAGAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1110s1c1
Sequence:CCGGCAAGATGGATTCCTGATCGAACTCGAGTTCGATCAGGAATCCATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1399s1c1
Sequence:CCGGCCTGGTCTATTGGGTTGGATACTCGAGTATCCAACCCAATAGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008074
GABRG3 MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, gamma 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008074.1-1441s1c1
Sequence:CCGGCTGAGGGATGACTGAAGAGTACTCGAGTACTCTTCAGTCATCCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1134s1c1
Sequence:CCGGGCCTTCAAGCACCCTCTAATTCTCGAGAATTAGAGGGTGCTTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-676s1c1
Sequence:CCGGGCGGCTCTATCAGTTTGACTTCTCGAGAAGTCAAACTGATAGAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1110s1c1
Sequence:CCGGCAAGATGGATTCCTGATCGAACTCGAGTTCGATCAGGAATCCATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1399s1c1
Sequence:CCGGCCTGGTCTATTGGGTTGGATACTCGAGTATCCAACCCAATAGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008074
GABRG3 MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, gamma 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008074.1-1441s1c1
Sequence:CCGGCTGAGGGATGACTGAAGAGTACTCGAGTACTCTTCAGTCATCCCTCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000088960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1134s1c1
Sequence:CCGGGCCTTCAAGCACCCTCTAATTCTCGAGAATTAGAGGGTGCTTGAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000088961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-676s1c1
Sequence:CCGGGCGGCTCTATCAGTTTGACTTCTCGAGAAGTCAAACTGATAGAGCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000088962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1110s1c1
Sequence:CCGGCAAGATGGATTCCTGATCGAACTCGAGTTCGATCAGGAATCCATCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000088959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008074.1-1399s1c1
Sequence:CCGGCCTGGTCTATTGGGTTGGATACTCGAGTATCCAACCCAATAGACCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???