EMAIL THIS PAGE TO A FRIEND

GABRP

gamma-aminobutyric acid (GABA) A receptor, pi

145 Gene Product Result for
UniProtKB ID: O00591, A8KA36, D3DQL2, Q32MJ1
Gene ID:
Human(2568) Summary: The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. The subunit encoded by this gene is expressed in several non-neuronal tissues including the uterus and ovaries. This subunit can assemble with known GABA A receptor subunits, and the presence of this subunit alters the sensitivity of recombinant receptors to modulatory agents such as pregnanolone. [provided by RefSeq, Jul 2008]
Mouse(216643) gamma-aminobutyric acid (GABA) A receptor, pi
Rat(81658) gamma-aminobutyric acid (GABA-A) receptor, pi
Zebrafish(566633) gamma-aminobutyric acid (GABA) A receptor, pi
dog(489124) gamma-aminobutyric acid (GABA) A receptor, pi
domestic cat(101095468) gamma-aminobutyric acid (GABA) A receptor, pi
Horse(100070350) gamma-aminobutyric acid (GABA) A receptor, pi
cow(517459) gamma-aminobutyric acid (GABA) A receptor, pi
chicken(416174) gamma-aminobutyric acid (GABA) A receptor, pi
sheep(101106625) gamma-aminobutyric acid (GABA) A receptor, pi
Domestic Rabbit(100339970) gamma-aminobutyric acid (GABA) A receptor, pi
naked mole-rat(101703647) gamma-aminobutyric acid (GABA) A receptor, pi
domestic guinea pig(100721816) gamma-aminobutyric acid (GABA) A receptor, pi
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV13034 Anti-GABRP antibody produced in rabbit affinity isolated antibody horse, human, rat, rabbit, canine, mouse
western blot pricing
SAB2107841 Anti-GABRP antibody produced in rabbit affinity isolated antibody rabbit, horse, human, mouse, canine, rat
ELISA, western blot pricing
SAB2106362 Anti-GABRP antibody produced in rabbit affinity isolated antibody human, horse, guinea pig, rabbit, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014211 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014211 Rosetta Predictions human pricing
NM_031029 Rosetta Predictions rat pricing
NM_146017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062085 predicted 1013
2 SASI_Hs01_00062087 predicted 692
3 SASI_Hs02_00345235 predicted 1246
4 SASI_Hs01_00062088 predicted 556
5 SASI_Hs01_00062089 predicted 922
6 SASI_Hs01_00062090 predicted 1399
7 SASI_Hs01_00062091 predicted 911
8 SASI_Hs01_00062092 predicted 1381
9 SASI_Hs01_00062093 predicted 356
10 SASI_Hs01_00062094 predicted 828
11 SASI_Hs01_00062086 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264231 predicted 758
2 SASI_Rn01_00064892 predicted 338
3 SASI_Rn01_00064893 predicted 900
4 SASI_Rn01_00064895 predicted 663
5 SASI_Rn01_00064896 predicted 626
6 SASI_Rn01_00064897 predicted 395
7 SASI_Rn01_00064898 predicted 388
8 SASI_Rn01_00064899 predicted 442
9 SASI_Rn01_00064900 predicted 500
10 SASI_Rn01_00064901 predicted 522
11 SASI_Rn01_00064894 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107741 predicted 1589
2 SASI_Mm01_00107742 predicted 496
3 SASI_Mm01_00107743 predicted 668
4 SASI_Mm01_00107744 predicted 998
5 SASI_Mm01_00107745 predicted 733
6 SASI_Mm01_00107746 predicted 775
7 SASI_Mm01_00107747 predicted 811
8 SASI_Mm01_00107748 predicted 601
9 SASI_Mm01_00107749 predicted 555
10 SASI_Mm01_00107750 predicted 1297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014211
GABRP MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, pi
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-386s21c1
Sequence:CCGGTAGCGCTGACTCTGGACATTGCTCGAGCAATGTCCAGAGTCAGCGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014211.2-1690s21c1
Sequence:CCGGGTGTAGAAGTCCTAGCATTATCTCGAGATAATGCTAGGACTTCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-1028s21c1
Sequence:CCGGTTGGAGTGACGACCGTGTTATCTCGAGATAACACGGTCGTCACTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-825s21c1
Sequence:CCGGGTACACCATAGAGCGGTATTTCTCGAGAAATACCGCTCTATGGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-831s1c1
Sequence:CCGGGACAGGAAATTACACTAGATTCTCGAGAATCTAGTGTAATTTCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1388s1c1
Sequence:CCGGCCAGTAATGTTGATCACTATTCTCGAGAATAGTGATCAACATTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-372s1c1
Sequence:CCGGCTCTAGCATTTCAGAGAGTAACTCGAGTTACTCTCTGAAATGCTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1114s1c1
Sequence:CCGGGCCTTGCTAGAATATGCAGTTCTCGAGAACTGCATATTCTAGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1320s1c1
Sequence:CCGGCGACAAGTTCAAGTTTGTCTTCTCGAGAAGACAAACTTGAACTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014211
GABRP MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, pi
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-386s21c1
Sequence:CCGGTAGCGCTGACTCTGGACATTGCTCGAGCAATGTCCAGAGTCAGCGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014211.2-1690s21c1
Sequence:CCGGGTGTAGAAGTCCTAGCATTATCTCGAGATAATGCTAGGACTTCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-1028s21c1
Sequence:CCGGTTGGAGTGACGACCGTGTTATCTCGAGATAACACGGTCGTCACTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-825s21c1
Sequence:CCGGGTACACCATAGAGCGGTATTTCTCGAGAAATACCGCTCTATGGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-831s1c1
Sequence:CCGGGACAGGAAATTACACTAGATTCTCGAGAATCTAGTGTAATTTCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1388s1c1
Sequence:CCGGCCAGTAATGTTGATCACTATTCTCGAGAATAGTGATCAACATTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-372s1c1
Sequence:CCGGCTCTAGCATTTCAGAGAGTAACTCGAGTTACTCTCTGAAATGCTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1114s1c1
Sequence:CCGGGCCTTGCTAGAATATGCAGTTCTCGAGAACTGCATATTCTAGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1320s1c1
Sequence:CCGGCGACAAGTTCAAGTTTGTCTTCTCGAGAAGACAAACTTGAACTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014211
GABRP MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, pi
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-386s21c1
Sequence:CCGGTAGCGCTGACTCTGGACATTGCTCGAGCAATGTCCAGAGTCAGCGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014211.2-1690s21c1
Sequence:CCGGGTGTAGAAGTCCTAGCATTATCTCGAGATAATGCTAGGACTTCTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-1028s21c1
Sequence:CCGGTTGGAGTGACGACCGTGTTATCTCGAGATAACACGGTCGTCACTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-825s21c1
Sequence:CCGGGTACACCATAGAGCGGTATTTCTCGAGAAATACCGCTCTATGGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-831s1c1
Sequence:CCGGGACAGGAAATTACACTAGATTCTCGAGAATCTAGTGTAATTTCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1388s1c1
Sequence:CCGGCCAGTAATGTTGATCACTATTCTCGAGAATAGTGATCAACATTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-372s1c1
Sequence:CCGGCTCTAGCATTTCAGAGAGTAACTCGAGTTACTCTCTGAAATGCTAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1114s1c1
Sequence:CCGGGCCTTGCTAGAATATGCAGTTCTCGAGAACTGCATATTCTAGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1320s1c1
Sequence:CCGGCGACAAGTTCAAGTTTGTCTTCTCGAGAAGACAAACTTGAACTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146017
GABRP MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, pi
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146017.2-1967s1c1
Sequence:CCGGGCGTCAATTCATTGGTGGTTACTCGAGTAACCACCAATGAATTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1383s1c1
Sequence:CCGGCCGCGAGAAGATCAGCAGAATCTCGAGATTCTGCTGATCTTCTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1444s1c1
Sequence:CCGGCGATACTCCAAACTACTATTTCTCGAGAAATAGTAGTTTGGAGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-588s1c1
Sequence:CCGGCCATGAAGTCACAGTGGGAAACTCGAGTTTCCCACTGTGACTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1357s1c1
Sequence:CCGGGCCAGCGACAAGTTTAAGTTTCTCGAGAAACTTAAACTTGTCGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146017
GABRP MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, pi
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146017.2-1967s1c1
Sequence:CCGGGCGTCAATTCATTGGTGGTTACTCGAGTAACCACCAATGAATTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1383s1c1
Sequence:CCGGCCGCGAGAAGATCAGCAGAATCTCGAGATTCTGCTGATCTTCTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1444s1c1
Sequence:CCGGCGATACTCCAAACTACTATTTCTCGAGAAATAGTAGTTTGGAGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-588s1c1
Sequence:CCGGCCATGAAGTCACAGTGGGAAACTCGAGTTTCCCACTGTGACTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1357s1c1
Sequence:CCGGGCCAGCGACAAGTTTAAGTTTCTCGAGAAACTTAAACTTGTCGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146017
GABRP MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, pi
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146017.2-1967s1c1
Sequence:CCGGGCGTCAATTCATTGGTGGTTACTCGAGTAACCACCAATGAATTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1383s1c1
Sequence:CCGGCCGCGAGAAGATCAGCAGAATCTCGAGATTCTGCTGATCTTCTCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1444s1c1
Sequence:CCGGCGATACTCCAAACTACTATTTCTCGAGAAATAGTAGTTTGGAGTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-588s1c1
Sequence:CCGGCCATGAAGTCACAGTGGGAAACTCGAGTTTCCCACTGTGACTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1357s1c1
Sequence:CCGGGCCAGCGACAAGTTTAAGTTTCTCGAGAAACTTAAACTTGTCGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)