EMAIL THIS PAGE TO A FRIEND

GABRP

gamma-aminobutyric acid (GABA) A receptor, pi

259 Gene Product Result for
UniProtKB ID: O00591, A8KA36, D3DQL2, Q32MJ1
Gene ID:
Human(2568) Summary: The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. The subunit encoded by this gene is expressed in several non-neuronal tissues including the uterus and ovaries. This subunit can assemble with known GABA A receptor subunits, and the presence of this subunit alters the sensitivity of recombinant receptors to modulatory agents such as pregnanolone. [provided by RefSeq, Jul 2008]
Mouse(216643) gamma-aminobutyric acid (GABA) A receptor, pi
Rat(81658) gamma-aminobutyric acid (GABA-A) receptor, pi
Zebrafish(566633) gamma-aminobutyric acid (GABA) A receptor, pi
dog(489124) gamma-aminobutyric acid (GABA) A receptor, pi
domestic cat(101095468) gamma-aminobutyric acid (GABA) A receptor, pi
Horse(100070350) gamma-aminobutyric acid (GABA) A receptor, pi
cow(517459) gamma-aminobutyric acid (GABA) A receptor, pi
chicken(416174) gamma-aminobutyric acid (GABA) A receptor, pi
sheep(101106625) gamma-aminobutyric acid (GABA) A receptor, pi
Domestic Rabbit(100339970) gamma-aminobutyric acid (GABA) A receptor, pi
naked mole-rat(101703647) gamma-aminobutyric acid (GABA) A receptor, pi
domestic guinea pig(100721816) gamma-aminobutyric acid (GABA) A receptor, pi
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107841 Anti-GABRP antibody produced in rabbit affinity isolated antibody horse, mouse, rat, human, dog, rabbit
western blot pricing
SAB2106362 Anti-GABRP antibody produced in rabbit affinity isolated antibody horse, bovine, guinea pig, mouse, rabbit, rat, human, dog
western blot pricing
AV13034 Anti-GABRP antibody produced in rabbit affinity isolated antibody rabbit, mouse, human, dog, horse, rat
immunohistochemistry, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
16730 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99.0% (GC) human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B6638 Butalbital human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C4782 Chlordiazepoxide hydrochloride drug standard, 1.0 mg/mL in methanol human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C4404 Clonazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E3638 Estazolam human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E1139 Estazolam solution drug standard, 100 μg/L in methanol human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F8763 Flunitrazepam solution drug standard, 1.0 mg/mL in methanol human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
F9134 Flurazepam dihydrochloride drug standard, 1.0 mg/mL in methanol human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
CDS019936 Isoflurane AldrichCPR human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O1755 Oxazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1503 Secobarbital analytical standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
S4006 Secobarbital solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
Y0001478 Thiopental for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D0899 Diazepam human, rat pricing
F9261 Flunitrazepam human, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
1273808 Flumazenil United States Pharmacopeia (USP) Reference Standard human pricing
F6300 Flumazenil >99% (HPLC), solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014211 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014211 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014211 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014211 Rosetta Predictions human pricing
NM_031029 Rosetta Predictions rat pricing
NM_146017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062085 predicted 1013
2 SASI_Hs01_00062087 predicted 692
3 SASI_Hs02_00345235 predicted 1246
4 SASI_Hs01_00062088 predicted 556
5 SASI_Hs01_00062089 predicted 922
6 SASI_Hs01_00062090 predicted 1399
7 SASI_Hs01_00062091 predicted 911
8 SASI_Hs01_00062092 predicted 1381
9 SASI_Hs01_00062093 predicted 356
10 SASI_Hs01_00062094 predicted 828
11 SASI_Hs01_00062086 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264231 predicted 758
2 SASI_Rn01_00064892 predicted 338
3 SASI_Rn01_00064893 predicted 900
4 SASI_Rn01_00064895 predicted 663
5 SASI_Rn01_00064896 predicted 626
6 SASI_Rn01_00064897 predicted 395
7 SASI_Rn01_00064898 predicted 388
8 SASI_Rn01_00064899 predicted 442
9 SASI_Rn01_00064900 predicted 500
10 SASI_Rn01_00064901 predicted 522
11 SASI_Rn01_00064894 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107741 predicted 1589
2 SASI_Mm01_00107742 predicted 496
3 SASI_Mm01_00107743 predicted 668
4 SASI_Mm01_00107744 predicted 998
5 SASI_Mm01_00107745 predicted 733
6 SASI_Mm01_00107746 predicted 775
7 SASI_Mm01_00107747 predicted 811
8 SASI_Mm01_00107748 predicted 601
9 SASI_Mm01_00107749 predicted 555
10 SASI_Mm01_00107750 predicted 1297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014211
GABRP MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, pi
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-386s21c1
Sequence:CCGGTAGCGCTGACTCTGGACATTGCTCGAGCAATGTCCAGAGTCAGCGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014211.2-1690s21c1
Sequence:CCGGGTGTAGAAGTCCTAGCATTATCTCGAGATAATGCTAGGACTTCTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-825s21c1
Sequence:CCGGGTACACCATAGAGCGGTATTTCTCGAGAAATACCGCTCTATGGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-831s1c1
Sequence:CCGGGACAGGAAATTACACTAGATTCTCGAGAATCTAGTGTAATTTCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-372s1c1
Sequence:CCGGCTCTAGCATTTCAGAGAGTAACTCGAGTTACTCTCTGAAATGCTAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1388s1c1
Sequence:CCGGCCAGTAATGTTGATCACTATTCTCGAGAATAGTGATCAACATTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1320s1c1
Sequence:CCGGCGACAAGTTCAAGTTTGTCTTCTCGAGAAGACAAACTTGAACTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1114s1c1
Sequence:CCGGGCCTTGCTAGAATATGCAGTTCTCGAGAACTGCATATTCTAGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-1028s21c1
Sequence:CCGGTTGGAGTGACGACCGTGTTATCTCGAGATAACACGGTCGTCACTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014211
GABRP MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, pi
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-386s21c1
Sequence:CCGGTAGCGCTGACTCTGGACATTGCTCGAGCAATGTCCAGAGTCAGCGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014211.2-1690s21c1
Sequence:CCGGGTGTAGAAGTCCTAGCATTATCTCGAGATAATGCTAGGACTTCTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-825s21c1
Sequence:CCGGGTACACCATAGAGCGGTATTTCTCGAGAAATACCGCTCTATGGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-831s1c1
Sequence:CCGGGACAGGAAATTACACTAGATTCTCGAGAATCTAGTGTAATTTCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-372s1c1
Sequence:CCGGCTCTAGCATTTCAGAGAGTAACTCGAGTTACTCTCTGAAATGCTAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1388s1c1
Sequence:CCGGCCAGTAATGTTGATCACTATTCTCGAGAATAGTGATCAACATTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1320s1c1
Sequence:CCGGCGACAAGTTCAAGTTTGTCTTCTCGAGAAGACAAACTTGAACTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1114s1c1
Sequence:CCGGGCCTTGCTAGAATATGCAGTTCTCGAGAACTGCATATTCTAGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-1028s21c1
Sequence:CCGGTTGGAGTGACGACCGTGTTATCTCGAGATAACACGGTCGTCACTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014211
GABRP MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, pi
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-386s21c1
Sequence:CCGGTAGCGCTGACTCTGGACATTGCTCGAGCAATGTCCAGAGTCAGCGCTATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000430714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014211.2-1690s21c1
Sequence:CCGGGTGTAGAAGTCCTAGCATTATCTCGAGATAATGCTAGGACTTCTACACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000430180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-825s21c1
Sequence:CCGGGTACACCATAGAGCGGTATTTCTCGAGAAATACCGCTCTATGGTGTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-831s1c1
Sequence:CCGGGACAGGAAATTACACTAGATTCTCGAGAATCTAGTGTAATTTCCTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-372s1c1
Sequence:CCGGCTCTAGCATTTCAGAGAGTAACTCGAGTTACTCTCTGAAATGCTAGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1388s1c1
Sequence:CCGGCCAGTAATGTTGATCACTATTCTCGAGAATAGTGATCAACATTACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1320s1c1
Sequence:CCGGCGACAAGTTCAAGTTTGTCTTCTCGAGAAGACAAACTTGAACTTGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014211.1-1114s1c1
Sequence:CCGGGCCTTGCTAGAATATGCAGTTCTCGAGAACTGCATATTCTAGCAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014211.2-1028s21c1
Sequence:CCGGTTGGAGTGACGACCGTGTTATCTCGAGATAACACGGTCGTCACTCCAATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146017
GABRP MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, pi
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1357s1c1
Sequence:CCGGGCCAGCGACAAGTTTAAGTTTCTCGAGAAACTTAAACTTGTCGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1444s1c1
Sequence:CCGGCGATACTCCAAACTACTATTTCTCGAGAAATAGTAGTTTGGAGTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146017.2-1967s1c1
Sequence:CCGGGCGTCAATTCATTGGTGGTTACTCGAGTAACCACCAATGAATTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1383s1c1
Sequence:CCGGCCGCGAGAAGATCAGCAGAATCTCGAGATTCTGCTGATCTTCTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-588s1c1
Sequence:CCGGCCATGAAGTCACAGTGGGAAACTCGAGTTTCCCACTGTGACTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146017
GABRP MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, pi
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1357s1c1
Sequence:CCGGGCCAGCGACAAGTTTAAGTTTCTCGAGAAACTTAAACTTGTCGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1444s1c1
Sequence:CCGGCGATACTCCAAACTACTATTTCTCGAGAAATAGTAGTTTGGAGTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146017.2-1967s1c1
Sequence:CCGGGCGTCAATTCATTGGTGGTTACTCGAGTAACCACCAATGAATTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1383s1c1
Sequence:CCGGCCGCGAGAAGATCAGCAGAATCTCGAGATTCTGCTGATCTTCTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-588s1c1
Sequence:CCGGCCATGAAGTCACAGTGGGAAACTCGAGTTTCCCACTGTGACTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146017
GABRP MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, pi
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1357s1c1
Sequence:CCGGGCCAGCGACAAGTTTAAGTTTCTCGAGAAACTTAAACTTGTCGCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000103054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1444s1c1
Sequence:CCGGCGATACTCCAAACTACTATTTCTCGAGAAATAGTAGTTTGGAGTATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000103050    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146017.2-1967s1c1
Sequence:CCGGGCGTCAATTCATTGGTGGTTACTCGAGTAACCACCAATGAATTGACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000103053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-1383s1c1
Sequence:CCGGCCGCGAGAAGATCAGCAGAATCTCGAGATTCTGCTGATCTTCTCGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000103052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146017.2-588s1c1
Sequence:CCGGCCATGAAGTCACAGTGGGAAACTCGAGTTTCCCACTGTGACTTCATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???