EMAIL THIS PAGE TO A FRIEND

GABRQ

gamma-aminobutyric acid (GABA) A receptor, theta

174 Gene Product Result for
Synonyms: THETA
UniProtKB ID: Q9UN88, A6NFN1, Q32MB4, Q9NZK8
Gene ID:
Human(55879) Summary: The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes the theta subunit of the GABA A receptor. The gene is mapped to chromosome Xq28 in a cluster of genes including those that encode the alpha 3 and epsilon subunits of the GABA A receptor. This gene location is also the candidate region of two different neurologic diseases: early-onset parkinsonism (Waisman syndrome) and X-linked mental retardation (MRX3). [provided by RefSeq, Nov 2009]
Mouse(57249) gamma-aminobutyric acid (GABA) A receptor, subunit theta
Rat(65187) gamma-aminobutyric acid (GABA) A receptor, theta
domestic guinea pig(100729123) gamma-aminobutyric acid (GABA) A receptor, theta
naked mole-rat(101714872) gamma-aminobutyric acid (GABA) A receptor, theta
sheep(101113305) gamma-aminobutyric acid (GABA) A receptor, theta
Domestic Rabbit(100352807) gamma-aminobutyric acid (GABA) A receptor, theta
chicken(396288) gamma-aminobutyric acid (GABA) A receptor, theta
cow(527180) gamma-aminobutyric acid (GABA) receptor, theta
Horse(100063455) gamma-aminobutyric acid (GABA) A receptor, theta
domestic cat(101099698) gamma-aminobutyric acid (GABA) A receptor, theta
dog(492225) gamma-aminobutyric acid (GABA) A receptor, theta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
L1764 (±)-Lorazepam human pricing
T1019 (±)-Thiopental human pricing
T1022 (±)Thiopental solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
56931 2,6-Diisopropylphenol analytical standard human pricing
B4388 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99% human pricing
16730 2-Bromo-2-chloro-1,1,1-trifluoroethane ≥99.0% (GC) human pricing
CDS019920 2-Chloro-1,1,2-trifluoroethyl difluoromethyl ether AldrichCPR human pricing
A6981 Acamprosate calcium ≥98% (HPLC), powder human pricing
BP1172 Acamprosate calcium British Pharmacopoeia (BP) Reference Standard human pricing
1000554 Acamprosate calcium United States Pharmacopeia (USP) Reference Standard, monograph mol wt. 400.48 (C10H20CaN2O8S2) human pricing
A8800 Alprazolam human pricing
A0357000 Alprazolam European Pharmacopoeia (EP) Reference Standard human pricing
A-903 Alprazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
611026 Alprazolam solution 1 mg/mL in methanol, analytical standard, for drug analysis human pricing
B-024 Butabarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1081002 Butalbital United States Pharmacopeia (USP) Reference Standard human pricing
B6638 Butalbital human pricing
B-006 Butalbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1110009 Chlordiazepoxide hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
C1500000 Chlordiazepoxide hydrochloride European Pharmacopoeia (EP) Reference Standard human pricing
C4782 Chlordiazepoxide hydrochloride drug standard, 1.0 mg/mL in methanol human pricing
C8414 Clobazam human pricing
BP507 Clobazam British Pharmacopoeia (BP) Reference Standard human pricing
C-909 Clobazam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C2385000 Clonazepam European Pharmacopoeia (EP) Reference Standard human pricing
BP484 Clonazepam British Pharmacopoeia (BP) Reference Standard human pricing
C-907 Clonazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
C4404 Clonazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1140509 Clorazepate dipotassium United States Pharmacopeia (USP) Reference Standard human pricing
1185008 Diazepam United States Pharmacopeia (USP) Reference Standard human pricing
D0940000 Diazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000596 Diazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
D-907 Diazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E3638 Estazolam human pricing
1249905 Estazolam United States Pharmacopeia (USP) Reference Standard human pricing
E-901 Estazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
E1139 Estazolam solution drug standard, 100 μg/L in methanol human pricing
E6530 Etomidate >98% (HPLC), powder human pricing
1268750 Etomidate United States Pharmacopeia (USP) Reference Standard human pricing
E2503000 Etomidate European Pharmacopoeia (EP) Reference Standard human pricing
BP840 Flunitrazepam British Pharmacopoeia (BP) Reference Standard human pricing
F0190000 Flunitrazepam European Pharmacopoeia (EP) Reference Standard human pricing
F-907 Flunitrazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
F8763 Flunitrazepam solution drug standard, 1.0 mg/mL in methanol human pricing
F-032 Flunitrazepam-13C6 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
F103 Flurazepam dihydrochloride solid human pricing
F9134 Flurazepam dihydrochloride drug standard, 1.0 mg/mL in methanol human pricing
1285002 Flurazepam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
F-044 Flurazepam-D4 solution 100 μg/mL in methanol, certified reference material, Cerilliant® human pricing
G-005 Glutethimide solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1303501 Halothane United States Pharmacopeia (USP) Reference Standard human pricing
792632 Isoflurane human pricing
CDS019936 Isoflurane AldrichCPR human pricing
1370305 Lorazepam United States Pharmacopeia (USP) Reference Standard human pricing
BP434 Lorazepam British Pharmacopoeia (BP) Reference Standard human pricing
L0750500 Lorazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000576 Lorazepam for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
L-901 Lorazepam solution 1.0 mg/mL in acetonitrile, ampule of 1 mL, certified reference material, Cerilliant® human pricing
M-015 Methaqualone solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1443602 Midazolam hydrochloride United States Pharmacopeia (USP) Reference Standard human pricing
M2419 Midazolam maleate salt human pricing
M-908 Midazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O5254 Oxazepam human pricing
O0225000 Oxazepam European Pharmacopoeia (EP) Reference Standard human pricing
Y0000543 Oxazepam for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
O-902 Oxazepam solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
O1755 Oxazepam solution drug standard, 1.0 mg/mL in methanol human pricing
1507002 Pentobarbital United States Pharmacopeia (USP) Reference Standard human pricing
P0500000 Pentobarbital European Pharmacopoeia (EP) Reference Standard human pricing
P-010 Pentobarbital solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P3654 Prazepam human pricing
1554501 Prazepam United States Pharmacopeia (USP) Reference Standard human pricing
P2669000 Prazepam European Pharmacopoeia (EP) Reference Standard human pricing
P-906 Prazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
P7295 Primidone analytical standard human pricing
BP293 Primidone British Pharmacopoeia (BP) Reference Standard human pricing
1562000 Primidone United States Pharmacopeia (USP) Reference Standard human pricing
P2950000 Primidone European Pharmacopoeia (EP) Reference Standard human pricing
Y0000369 Primidone for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-075 Primidone solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
PHR1663 Propofol Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1572503 Propofol United States Pharmacopeia (USP) Reference Standard human pricing
Y0000016 Propofol European Pharmacopoeia (EP) Reference Standard human pricing
BP1031 Propofol British Pharmacopoeia (BP) Reference Standard human pricing
Y0000017 Propofol for peak identification European Pharmacopoeia (EP) Reference Standard human pricing
P-076 Propofol solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
1611004 Secobarbital United States Pharmacopeia (USP) Reference Standard human pricing
S1503 Secobarbital analytical standard human pricing
S1378 Secobarbital sodium salt human pricing
S-002 Secobarbital solution 1 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
S4006 Secobarbital solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human pricing
T8275 Temazepam analytical standard human pricing
BP455 Temazepam British Pharmacopoeia (BP) Reference Standard human pricing
1643408 Temazepam United States Pharmacopeia (USP) Reference Standard human pricing
T-907 Temazepam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9799 Thiamylal analytical standard human pricing
1661002 Thiopental United States Pharmacopeia (USP) Reference Standard human pricing
T1200000 Thiopental European Pharmacopoeia (EP) Reference Standard human pricing
Y0001478 Thiopental for system suitability European Pharmacopoeia (EP) Reference Standard human pricing
PHR1600 Topiramate Pharmaceutical Secondary Standard; Certified Reference Material human pricing
1672206 Topiramate United States Pharmacopeia (USP) Reference Standard human pricing
Y0002134 Topiramate European Pharmacopoeia (EP) Reference Standard human pricing
T-039 Topiramate solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
T9772 Triazolam human pricing
T1975000 Triazolam European Pharmacopoeia (EP) Reference Standard human pricing
T-910 Triazolam solution 1.0 mg/mL in methanol, ampule of 1 mL, certified reference material, Cerilliant® human pricing
G7795 Ganaxolone solid human, mouse pricing
P8887 5α-Pregnan-3α-ol-20-one solid human, mouse, rat pricing
D9900 Diazepam solution 1.0 mg/mL in methanol, analytical standard, for drug analysis human, mouse, rat pricing
UC429 Midazolam hydrochloride solid human, mouse, rat pricing
T0575 Topiramate ≥98% (HPLC), solid human, mouse, rat pricing
D126608 2,6-Diisopropylphenol 97% human, rat pricing
C1277 Clonazepam powder human, rat pricing
D0899 Diazepam human, rat pricing
F9261 Flunitrazepam human, rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
1273808 Flumazenil United States Pharmacopeia (USP) Reference Standard human pricing
F6300 Flumazenil >99% (HPLC), solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018558 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018558 Rosetta Predictions human pricing
NM_031733 Rosetta Predictions rat pricing
NM_020488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220026 predicted 988
2 SASI_Hs01_00220027 predicted 293
3 SASI_Hs01_00220028 predicted 623
4 SASI_Hs01_00220029 predicted 834
5 SASI_Hs02_00352108 predicted 446
6 SASI_Hs01_00220030 predicted 739
7 SASI_Hs02_00352109 predicted 1129
8 SASI_Hs01_00220031 predicted 1687
9 SASI_Hs01_00220032 predicted 639
10 SASI_Hs01_00220033 predicted 276
11 SASI_Hs01_00220034 predicted 858
12 SASI_Hs01_00220035 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043754 predicted 1230
2 SASI_Rn01_00043755 predicted 947
3 SASI_Rn01_00043756 predicted 1365
4 SASI_Rn02_00265117 predicted 1462
5 SASI_Rn01_00043757 predicted 255
6 SASI_Rn01_00043758 predicted 1473
7 SASI_Rn01_00043760 predicted 1560
8 SASI_Rn01_00043761 predicted 431
9 SASI_Rn01_00043762 predicted 244
10 SASI_Rn01_00043763 predicted 1090
11 SASI_Rn01_00043759 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099178 predicted 1401
2 SASI_Mm01_00099179 predicted 908
3 SASI_Mm01_00099180 predicted 1139
4 SASI_Mm01_00099181 predicted 218
5 SASI_Mm01_00099182 predicted 275
6 SASI_Mm01_00099183 predicted 1311
7 SASI_Mm01_00099184 predicted 1124
8 SASI_Mm01_00099185 predicted 763
9 SASI_Mm01_00099186 predicted 371
10 SASI_Mm01_00099187 predicted 1505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020488
GABRQ MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, theta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-903s1c1
Sequence:CCGGGCCAGGGTAACTATTGGACTACTCGAGTAGTCCAATAGTTACCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-378s1c1
Sequence:CCGGGCTTACTATGAAACCAACCTACTCGAGTAGGTTGGTTTCATAGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-379s1c1
Sequence:CCGGCTTACTATGAAACCAACCTAACTCGAGTTAGGTTGGTTTCATAGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-904s1c1
Sequence:CCGGCCAGGGTAACTATTGGACTAACTCGAGTTAGTCCAATAGTTACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-1412s1c1
Sequence:CCGGGCCTGAGTGTACCATTCACTTCTCGAGAAGTGAATGGTACACTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020488
GABRQ MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, theta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-903s1c1
Sequence:CCGGGCCAGGGTAACTATTGGACTACTCGAGTAGTCCAATAGTTACCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-378s1c1
Sequence:CCGGGCTTACTATGAAACCAACCTACTCGAGTAGGTTGGTTTCATAGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-379s1c1
Sequence:CCGGCTTACTATGAAACCAACCTAACTCGAGTTAGGTTGGTTTCATAGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-904s1c1
Sequence:CCGGCCAGGGTAACTATTGGACTAACTCGAGTTAGTCCAATAGTTACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-1412s1c1
Sequence:CCGGGCCTGAGTGTACCATTCACTTCTCGAGAAGTGAATGGTACACTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020488
GABRQ MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, theta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-903s1c1
Sequence:CCGGGCCAGGGTAACTATTGGACTACTCGAGTAGTCCAATAGTTACCCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-378s1c1
Sequence:CCGGGCTTACTATGAAACCAACCTACTCGAGTAGGTTGGTTTCATAGTAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-379s1c1
Sequence:CCGGCTTACTATGAAACCAACCTAACTCGAGTTAGGTTGGTTTCATAGTAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-904s1c1
Sequence:CCGGCCAGGGTAACTATTGGACTAACTCGAGTTAGTCCAATAGTTACCCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020488.1-1412s1c1
Sequence:CCGGGCCTGAGTGTACCATTCACTTCTCGAGAAGTGAATGGTACACTCAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018558
GABRQ MISSION shRNA Bacterial Glycerol Stock
gamma-aminobutyric acid (GABA) A receptor, theta
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-1648s1c1
Sequence:CCGGGCCTTGCCATTAAGGAGCAATCTCGAGATTGCTCCTTAATGGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-269s1c1
Sequence:CCGGGCCTGTGAGAATATCTATTTACTCGAGTAAATAGATATTCTCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-988s1c1
Sequence:CCGGCCTGTATCAAGGCCATTGATACTCGAGTATCAATGGCCTTGATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-856s1c1
Sequence:CCGGCCACTATTACCTCTTGGATATCTCGAGATATCCAAGAGGTAATAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-107s1c1
Sequence:CCGGCCCGAAATTCCACTTCGAGTTCTCGAGAACTCGAAGTGGAATTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018558.2-1407s21c1
Sequence:CCGGAGCTATGGTGTTCGCTTTAATCTCGAGATTAAAGCGAACACCATAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018558.2-1054s21c1
Sequence:CCGGAGTATGTCTACATCAACTATCCTCGAGGATAGTTGATGTAGACATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018558
GABRQ MISSION shRNA shRNA Plasmid DNA
gamma-aminobutyric acid (GABA) A receptor, theta
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-1648s1c1
Sequence:CCGGGCCTTGCCATTAAGGAGCAATCTCGAGATTGCTCCTTAATGGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-269s1c1
Sequence:CCGGGCCTGTGAGAATATCTATTTACTCGAGTAAATAGATATTCTCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-988s1c1
Sequence:CCGGCCTGTATCAAGGCCATTGATACTCGAGTATCAATGGCCTTGATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-856s1c1
Sequence:CCGGCCACTATTACCTCTTGGATATCTCGAGATATCCAAGAGGTAATAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-107s1c1
Sequence:CCGGCCCGAAATTCCACTTCGAGTTCTCGAGAACTCGAAGTGGAATTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018558.2-1407s21c1
Sequence:CCGGAGCTATGGTGTTCGCTTTAATCTCGAGATTAAAGCGAACACCATAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018558.2-1054s21c1
Sequence:CCGGAGTATGTCTACATCAACTATCCTCGAGGATAGTTGATGTAGACATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018558
GABRQ MISSION shRNA Lentiviral Transduction Particles
gamma-aminobutyric acid (GABA) A receptor, theta
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-1648s1c1
Sequence:CCGGGCCTTGCCATTAAGGAGCAATCTCGAGATTGCTCCTTAATGGCAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-269s1c1
Sequence:CCGGGCCTGTGAGAATATCTATTTACTCGAGTAAATAGATATTCTCACAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-988s1c1
Sequence:CCGGCCTGTATCAAGGCCATTGATACTCGAGTATCAATGGCCTTGATACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-856s1c1
Sequence:CCGGCCACTATTACCTCTTGGATATCTCGAGATATCCAAGAGGTAATAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000063604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018558.1-107s1c1
Sequence:CCGGCCCGAAATTCCACTTCGAGTTCTCGAGAACTCGAAGTGGAATTTCGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018558.2-1407s21c1
Sequence:CCGGAGCTATGGTGTTCGCTTTAATCTCGAGATTAAAGCGAACACCATAGCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000416891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018558.2-1054s21c1
Sequence:CCGGAGTATGTCTACATCAACTATCCTCGAGGATAGTTGATGTAGACATACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???