EMAIL THIS PAGE TO A FRIEND

GAGE12D

G antigen 12D

12 Gene Product Result for
Synonyms: GAGE-12B
Species: Human GAGE12D(100132399)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001127199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001127199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001127199 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127199 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328717 predicted 331
2 SASI_Hs02_00328718 predicted 209
3 SASI_Hs02_00328719 predicted 325
4 SASI_Hs02_00328720 predicted 211
5 SASI_Hs02_00328721 predicted 208
6 SASI_Hs02_00328722 predicted 331
7 SASI_Hs02_00328723 predicted 258
8 SASI_Hs02_00328724 predicted 233
9 SASI_Hs02_00328725 predicted 209
10 SASI_Hs02_00328726 predicted 165
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001127199
GAGE12D MISSION shRNA Bacterial Glycerol Stock
G antigen 12D
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-384s21c1
Sequence:CCGGGTGAGTGTGAAGATGGTCCTGCTCGAGCAGGACCATCTTCACACTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-190s21c1
Sequence:CCGGTGAAATGATTGGGCCTATGCGCTCGAGCGCATAGGCCCAATCATTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-264s21c1
Sequence:CCGGCAGCAACTCAATGTCAGGATCCTCGAGGATCCTGACATTGAGTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-164s21c1
Sequence:CCGGAGACCAAGGCGCTATGTACAGCTCGAGCTGTACATAGCGCCTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-177s21c1
Sequence:CCGGATGTACAGCCTCCTGAAATGACTCGAGTCATTTCAGGAGGCTGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001127199
GAGE12D MISSION shRNA shRNA Plasmid DNA
G antigen 12D
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-384s21c1
Sequence:CCGGGTGAGTGTGAAGATGGTCCTGCTCGAGCAGGACCATCTTCACACTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-190s21c1
Sequence:CCGGTGAAATGATTGGGCCTATGCGCTCGAGCGCATAGGCCCAATCATTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-264s21c1
Sequence:CCGGCAGCAACTCAATGTCAGGATCCTCGAGGATCCTGACATTGAGTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-164s21c1
Sequence:CCGGAGACCAAGGCGCTATGTACAGCTCGAGCTGTACATAGCGCCTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-177s21c1
Sequence:CCGGATGTACAGCCTCCTGAAATGACTCGAGTCATTTCAGGAGGCTGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001127199
GAGE12D MISSION shRNA Lentiviral Transduction Particles
G antigen 12D
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-384s21c1
Sequence:CCGGGTGAGTGTGAAGATGGTCCTGCTCGAGCAGGACCATCTTCACACTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-190s21c1
Sequence:CCGGTGAAATGATTGGGCCTATGCGCTCGAGCGCATAGGCCCAATCATTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-264s21c1
Sequence:CCGGCAGCAACTCAATGTCAGGATCCTCGAGGATCCTGACATTGAGTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-164s21c1
Sequence:CCGGAGACCAAGGCGCTATGTACAGCTCGAGCTGTACATAGCGCCTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001127199.1-177s21c1
Sequence:CCGGATGTACAGCCTCCTGAAATGACTCGAGTCATTTCAGGAGGCTGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)