EMAIL THIS PAGE TO A FRIEND

GAL3ST1

galactose-3-O-sulfotransferase 1

46 Gene Product Result for
Synonyms: CST
UniProtKB ID: Q99999, Q96C63
Gene ID:
Human(9514) Summary: Sulfonation, an important step in the metabolism of many drugs, xenobiotics, hormones, and neurotransmitters, is catalyzed by sulfotransferases. The product of this gene is galactosylceramide sulfotransferase which catalyzes the conversion between 3'-phosphoadenylylsulfate + a galactosylceramide to adenosine 3',5'-bisphosphate + galactosylceramide sulfate. Activity of this sulfotransferase is enhanced in renal cell carcinoma. [provided by RefSeq, Jul 2008]
Mouse(53897) galactose-3-O-sulfotransferase 1
Rat(683713) galactose-3-O-sulfotransferase 1
Zebrafish(793735) galactose-3-O-sulfotransferase 1
dog(611960) galactose-3-O-sulfotransferase 1
cow(513295) galactose-3-O-sulfotransferase 1
domestic cat(101092797) galactose-3-O-sulfotransferase 1
chicken(417006) galactose-3-O-sulfotransferase 1
sheep(101112599) galactose-3-O-sulfotransferase 1
domestic guinea pig(100735507) galactose-3-O-sulfotransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004861 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004861 Rosetta Predictions human pricing
NM_001109447 Rosetta Predictions rat pricing
NM_016922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219866 predicted 762
2 SASI_Hs01_00219867 predicted 419
3 SASI_Hs01_00219868 predicted 494
4 SASI_Hs01_00219869 predicted 662
5 SASI_Hs01_00219870 predicted 423
6 SASI_Hs01_00219871 predicted 1015
7 SASI_Hs01_00219872 predicted 853
8 SASI_Hs01_00219873 predicted 517
9 SASI_Hs01_00219874 predicted 521
10 SASI_Hs01_00219875 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109447 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248497 predicted 1631
2 SASI_Rn02_00248498 predicted 1527
3 SASI_Rn02_00248499 predicted 308
4 SASI_Rn02_00248500 predicted 1548
5 SASI_Rn02_00248501 predicted 286
6 SASI_Rn02_00248502 predicted 893
7 SASI_Rn02_00248503 predicted 552
8 SASI_Rn02_00248504 predicted 294
9 SASI_Rn02_00248505 predicted 379
10 SASI_Rn02_00248506 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098620 predicted 581
2 SASI_Mm01_00098621 predicted 411
3 SASI_Mm01_00098622 predicted 424
4 SASI_Mm01_00098623 predicted 569
5 SASI_Mm01_00098624 predicted 918
6 SASI_Mm01_00098625 predicted 1295
7 SASI_Mm01_00098626 predicted 640
8 SASI_Mm01_00098627 predicted 569
9 SASI_Mm01_00098628 predicted 1552
10 SASI_Mm01_00098629 predicted 1539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016922
GAL3ST1 MISSION shRNA Bacterial Glycerol Stock
galactose-3-O-sulfotransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016922.2-583s1c1
Sequence:CCGGGCGAGATATTGTGTTCATGAACTCGAGTTCATGAACACAATATCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016922.2-1644s1c1
Sequence:CCGGCCTCCTGTTTGGCTTCCTGATCTCGAGATCAGGAAGCCAAACAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016922.2-1477s1c1
Sequence:CCGGCCTGGGTTACAACCTCAAGAACTCGAGTTCTTGAGGTTGTAACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016922.2-1174s1c1
Sequence:CCGGCGTGCTGTATTTCAAGCTCAACTCGAGTTGAGCTTGAAATACAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016922.2-427s1c1
Sequence:CCGGCAGTTTCCTATTGCTGCTGTACTCGAGTACAGCAGCAATAGGAAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016922
GAL3ST1 MISSION shRNA shRNA Plasmid DNA
galactose-3-O-sulfotransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016922.2-583s1c1
Sequence:CCGGGCGAGATATTGTGTTCATGAACTCGAGTTCATGAACACAATATCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016922.2-1644s1c1
Sequence:CCGGCCTCCTGTTTGGCTTCCTGATCTCGAGATCAGGAAGCCAAACAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016922.2-1477s1c1
Sequence:CCGGCCTGGGTTACAACCTCAAGAACTCGAGTTCTTGAGGTTGTAACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016922.2-1174s1c1
Sequence:CCGGCGTGCTGTATTTCAAGCTCAACTCGAGTTGAGCTTGAAATACAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016922.2-427s1c1
Sequence:CCGGCAGTTTCCTATTGCTGCTGTACTCGAGTACAGCAGCAATAGGAAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016922
GAL3ST1 MISSION shRNA Lentiviral Transduction Particles
galactose-3-O-sulfotransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016922.2-583s1c1
Sequence:CCGGGCGAGATATTGTGTTCATGAACTCGAGTTCATGAACACAATATCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099305    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016922.2-1644s1c1
Sequence:CCGGCCTCCTGTTTGGCTTCCTGATCTCGAGATCAGGAAGCCAAACAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016922.2-1477s1c1
Sequence:CCGGCCTGGGTTACAACCTCAAGAACTCGAGTTCTTGAGGTTGTAACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016922.2-1174s1c1
Sequence:CCGGCGTGCTGTATTTCAAGCTCAACTCGAGTTGAGCTTGAAATACAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016922.2-427s1c1
Sequence:CCGGCAGTTTCCTATTGCTGCTGTACTCGAGTACAGCAGCAATAGGAAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004861
GAL3ST1 MISSION shRNA Bacterial Glycerol Stock
galactose-3-O-sulfotransferase 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-428s1c1
Sequence:CCGGGCGCAACATCGTGTTCTTGAACTCGAGTTCAAGAACACGATGTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-713s1c1
Sequence:CCGGCGAGTCCTCCTTCCACTACTTCTCGAGAAGTAGTGGAAGGAGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-263s1c1
Sequence:CCGGGCTCTTCACTAGTTTCCTGCTCTCGAGAGCAGGAAACTAGTGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-953s1c1
Sequence:CCGGCCTTCAAGAGTACTTCGACGACTCGAGTCGTCGAAGTACTCTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-1442s1c1
Sequence:CCGGCTGGAAGTTCATTCGCGATTTCTCGAGAAATCGCGAATGAACTTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004861
GAL3ST1 MISSION shRNA shRNA Plasmid DNA
galactose-3-O-sulfotransferase 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-428s1c1
Sequence:CCGGGCGCAACATCGTGTTCTTGAACTCGAGTTCAAGAACACGATGTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-713s1c1
Sequence:CCGGCGAGTCCTCCTTCCACTACTTCTCGAGAAGTAGTGGAAGGAGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-263s1c1
Sequence:CCGGGCTCTTCACTAGTTTCCTGCTCTCGAGAGCAGGAAACTAGTGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-953s1c1
Sequence:CCGGCCTTCAAGAGTACTTCGACGACTCGAGTCGTCGAAGTACTCTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-1442s1c1
Sequence:CCGGCTGGAAGTTCATTCGCGATTTCTCGAGAAATCGCGAATGAACTTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004861
GAL3ST1 MISSION shRNA Lentiviral Transduction Particles
galactose-3-O-sulfotransferase 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-428s1c1
Sequence:CCGGGCGCAACATCGTGTTCTTGAACTCGAGTTCAAGAACACGATGTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-713s1c1
Sequence:CCGGCGAGTCCTCCTTCCACTACTTCTCGAGAAGTAGTGGAAGGAGGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-263s1c1
Sequence:CCGGGCTCTTCACTAGTTTCCTGCTCTCGAGAGCAGGAAACTAGTGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-953s1c1
Sequence:CCGGCCTTCAAGAGTACTTCGACGACTCGAGTCGTCGAAGTACTCTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004861.1-1442s1c1
Sequence:CCGGCTGGAAGTTCATTCGCGATTTCTCGAGAAATCGCGAATGAACTTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)