EMAIL THIS PAGE TO A FRIEND

GALNS

galactosamine (N-acetyl)-6-sulfate sulfatase

53 Gene Product Result for
Synonyms: GALNAC6S GAS GalN6S MPS4A
UniProtKB ID: P34059, Q86VK3
Gene ID:
Human(2588) Summary: This gene encodes N-acetylgalactosamine-6-sulfatase which is a lysosomal exohydrolase required for the degradation of the glycosaminoglycans, keratan sulfate, and chondroitin 6-sulfate. Sequence alterations including point, missense and nonsense mutations, as well as those that affect splicing, result in a deficiency of this enzyme. Deficiencies of this enzyme lead to Morquio A syndrome, a lysosomal storage disorder. [provided by RefSeq, Jul 2008]
Mouse(50917) galactosamine (N-acetyl)-6-sulfate sulfatase
Rat(292073) galactosamine (N-acetyl)-6-sulfate sulfatase
Zebrafish(791159) galactosamine (N-acetyl)-6-sulfate sulfatase
domestic cat(101099168) galactosamine (N-acetyl)-6-sulfate sulfatase
cow(515809) galactosamine (N-acetyl)-6-sulfate sulfatase
dog(489661) galactosamine (N-acetyl)-6-sulfate sulfatase
chicken(415848) galactosamine (N-acetyl)-6-sulfate sulfatase
domestic guinea pig(100732880) galactosamine (N-acetyl)-6-sulfate sulfatase
naked mole-rat(101712119) galactosamine (N-acetyl)-6-sulfate sulfatase
sheep(101107214) galactosamine (N-acetyl)-6-sulfate sulfatase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000512 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000512 Rosetta Predictions human pricing
NM_001047851 Rosetta Predictions rat pricing
NM_016722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205715 predicted 634
2 SASI_Hs02_00302701 predicted 1103
3 SASI_Hs01_00205716 predicted 398
4 SASI_Hs01_00205717 predicted 1608
5 SASI_Hs01_00205718 predicted 295
6 SASI_Hs01_00205719 predicted 700
7 SASI_Hs01_00205720 predicted 1301
8 SASI_Hs01_00205721 predicted 616
9 SASI_Hs02_00302702 predicted 798
10 SASI_Hs01_00205722 predicted 576
11 SASI_Hs01_00205723 predicted 1241
12 SASI_Hs01_00205724 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206185 predicted 1178
2 SASI_Rn02_00206186 predicted 1260
3 SASI_Rn02_00206187 predicted 410
4 SASI_Rn02_00206188 predicted 548
5 SASI_Rn02_00206189 predicted 550
6 SASI_Rn02_00206190 predicted 779
7 SASI_Rn02_00206191 predicted 207
8 SASI_Rn02_00206192 predicted 833
9 SASI_Rn02_00206193 predicted 1135
10 SASI_Rn02_00206194 predicted 1263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106133 predicted 1169
2 SASI_Mm01_00106135 predicted 1458
3 SASI_Mm01_00106134 predicted 1557
4 SASI_Mm01_00106136 predicted 1013
5 SASI_Mm01_00106137 predicted 203
6 SASI_Mm01_00106138 predicted 390
7 SASI_Mm01_00106139 predicted 371
8 SASI_Mm02_00323427 predicted 464
9 SASI_Mm02_00323428 predicted 619
10 SASI_Mm02_00323429 predicted 870
11 SASI_Mm01_00106132 predicted 225
12 SASI_Mm01_00106140 predicted 695
13 SASI_Mm01_00106141 predicted 826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016722
VALIDATED
GALNS MISSION shRNA Bacterial Glycerol Stock
galactosamine (N-acetyl)-6-sulfate sulfatase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016722.2-1844s1c1
Sequence:CCGGCCCTGCATACATTTCAACCTACTCGAGTAGGTTGAAATGTATGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016722.2-1545s1c1
Sequence:CCGGGAAGTGTTTCTGGGCCCATTACTCGAGTAATGGGCCCAGAAACACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016722.2-206s1c1
Sequence:CCGGGCTTCTATTCTGCCAACCCTTCTCGAGAAGGGTTGGCAGAATAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016722.2-96s1c1
Sequence:CCGGGCTACTGCTCATGGACGATATCTCGAGATATCGTCCATGAGCAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016722.2-453s1c1
Sequence:CCGGGCATGGATTTGACGAGTGGTTCTCGAGAACCACTCGTCAAATCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016722.3-453s21c1
Sequence:CCGGGCATGGATTTGACGAGTGGTTCTCGAGAACCACTCGTCAAATCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016722.3-1844s21c1
Sequence:CCGGCCCTGCATACATTTCAACCTACTCGAGTAGGTTGAAATGTATGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016722.3-206s21c1
Sequence:CCGGGCTTCTATTCTGCCAACCCTTCTCGAGAAGGGTTGGCAGAATAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016722.3-760s21c1
Sequence:CCGGGGCGATGCTGTTCGGGAAATACTCGAGTATTTCCCGAACAGCATCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016722.3-96s21c1
Sequence:CCGGGCTACTGCTCATGGACGATATCTCGAGATATCGTCCATGAGCAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016722
VALIDATED
GALNS MISSION shRNA shRNA Plasmid DNA
galactosamine (N-acetyl)-6-sulfate sulfatase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016722.2-1844s1c1
Sequence:CCGGCCCTGCATACATTTCAACCTACTCGAGTAGGTTGAAATGTATGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016722.2-1545s1c1
Sequence:CCGGGAAGTGTTTCTGGGCCCATTACTCGAGTAATGGGCCCAGAAACACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016722.2-206s1c1
Sequence:CCGGGCTTCTATTCTGCCAACCCTTCTCGAGAAGGGTTGGCAGAATAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016722.2-96s1c1
Sequence:CCGGGCTACTGCTCATGGACGATATCTCGAGATATCGTCCATGAGCAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016722.2-453s1c1
Sequence:CCGGGCATGGATTTGACGAGTGGTTCTCGAGAACCACTCGTCAAATCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016722.3-453s21c1
Sequence:CCGGGCATGGATTTGACGAGTGGTTCTCGAGAACCACTCGTCAAATCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016722.3-1844s21c1
Sequence:CCGGCCCTGCATACATTTCAACCTACTCGAGTAGGTTGAAATGTATGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016722.3-206s21c1
Sequence:CCGGGCTTCTATTCTGCCAACCCTTCTCGAGAAGGGTTGGCAGAATAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016722.3-760s21c1
Sequence:CCGGGGCGATGCTGTTCGGGAAATACTCGAGTATTTCCCGAACAGCATCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016722.3-96s21c1
Sequence:CCGGGCTACTGCTCATGGACGATATCTCGAGATATCGTCCATGAGCAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016722
VALIDATED
GALNS MISSION shRNA Lentiviral Transduction Particles
galactosamine (N-acetyl)-6-sulfate sulfatase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016722.2-1844s1c1
Sequence:CCGGCCCTGCATACATTTCAACCTACTCGAGTAGGTTGAAATGTATGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016722.2-1545s1c1
Sequence:CCGGGAAGTGTTTCTGGGCCCATTACTCGAGTAATGGGCCCAGAAACACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016722.2-206s1c1
Sequence:CCGGGCTTCTATTCTGCCAACCCTTCTCGAGAAGGGTTGGCAGAATAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016722.2-96s1c1
Sequence:CCGGGCTACTGCTCATGGACGATATCTCGAGATATCGTCCATGAGCAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016722.2-453s1c1
Sequence:CCGGGCATGGATTTGACGAGTGGTTCTCGAGAACCACTCGTCAAATCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016722.3-453s21c1
Sequence:CCGGGCATGGATTTGACGAGTGGTTCTCGAGAACCACTCGTCAAATCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016722.3-1844s21c1
Sequence:CCGGCCCTGCATACATTTCAACCTACTCGAGTAGGTTGAAATGTATGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016722.3-206s21c1
Sequence:CCGGGCTTCTATTCTGCCAACCCTTCTCGAGAAGGGTTGGCAGAATAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016722.3-760s21c1
Sequence:CCGGGGCGATGCTGTTCGGGAAATACTCGAGTATTTCCCGAACAGCATCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016722.3-96s21c1
Sequence:CCGGGCTACTGCTCATGGACGATATCTCGAGATATCGTCCATGAGCAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000512
VALIDATED
GALNS MISSION shRNA Bacterial Glycerol Stock
galactosamine (N-acetyl)-6-sulfate sulfatase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-830s1c1
Sequence:CCGGCGGGAGATTGATGACAGCATTCTCGAGAATGCTGTCATCAATCTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-515s1c1
Sequence:CCGGCACGGATTTGATGAGTGGTTTCTCGAGAAACCACTCATCAAATCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-1516s1c1
Sequence:CCGGCGTGTGCAACTGGGCGGTCATCTCGAGATGACCGCCCAGTTGCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-886s1c1
Sequence:CCGGCGCGGACAACACCTTCGTCTTCTCGAGAAGACGAAGGTGTTGTCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-614s1c1
Sequence:CCGGGTTGGCAGATATTATGAAGAACTCGAGTTCTTCATAATATCTGCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000512.4-641s21c1
Sequence:CCGGGGAGATGGTTGGCAGATATTACTCGAGTAATATCTGCCAACCATCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000512.4-1322s21c1
Sequence:CCGGCTTCAGACAGGGCATTGATTTCTCGAGAAATCAATGCCCTGTCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000512.4-1948s21c1
Sequence:CCGGGAGACCAGTCTCAGTTTATTTCTCGAGAAATAAACTGAGACTGGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000512.4-1222s21c1
Sequence:CCGGTGGACAGGCCTATCTTCTATTCTCGAGAATAGAAGATAGGCCTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000512
VALIDATED
GALNS MISSION shRNA shRNA Plasmid DNA
galactosamine (N-acetyl)-6-sulfate sulfatase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-830s1c1
Sequence:CCGGCGGGAGATTGATGACAGCATTCTCGAGAATGCTGTCATCAATCTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-515s1c1
Sequence:CCGGCACGGATTTGATGAGTGGTTTCTCGAGAAACCACTCATCAAATCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-1516s1c1
Sequence:CCGGCGTGTGCAACTGGGCGGTCATCTCGAGATGACCGCCCAGTTGCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-886s1c1
Sequence:CCGGCGCGGACAACACCTTCGTCTTCTCGAGAAGACGAAGGTGTTGTCCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-614s1c1
Sequence:CCGGGTTGGCAGATATTATGAAGAACTCGAGTTCTTCATAATATCTGCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000512.4-641s21c1
Sequence:CCGGGGAGATGGTTGGCAGATATTACTCGAGTAATATCTGCCAACCATCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000512.4-1322s21c1
Sequence:CCGGCTTCAGACAGGGCATTGATTTCTCGAGAAATCAATGCCCTGTCTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000512.4-1948s21c1
Sequence:CCGGGAGACCAGTCTCAGTTTATTTCTCGAGAAATAAACTGAGACTGGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000512.4-1222s21c1
Sequence:CCGGTGGACAGGCCTATCTTCTATTCTCGAGAATAGAAGATAGGCCTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000512
VALIDATED
GALNS MISSION shRNA Lentiviral Transduction Particles
galactosamine (N-acetyl)-6-sulfate sulfatase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-830s1c1
Sequence:CCGGCGGGAGATTGATGACAGCATTCTCGAGAATGCTGTCATCAATCTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-515s1c1
Sequence:CCGGCACGGATTTGATGAGTGGTTTCTCGAGAAACCACTCATCAAATCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-1516s1c1
Sequence:CCGGCGTGTGCAACTGGGCGGTCATCTCGAGATGACCGCCCAGTTGCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-886s1c1
Sequence:CCGGCGCGGACAACACCTTCGTCTTCTCGAGAAGACGAAGGTGTTGTCCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000512.2-614s1c1
Sequence:CCGGGTTGGCAGATATTATGAAGAACTCGAGTTCTTCATAATATCTGCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000512.4-641s21c1
Sequence:CCGGGGAGATGGTTGGCAGATATTACTCGAGTAATATCTGCCAACCATCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000512.4-1322s21c1
Sequence:CCGGCTTCAGACAGGGCATTGATTTCTCGAGAAATCAATGCCCTGTCTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000512.4-1948s21c1
Sequence:CCGGGAGACCAGTCTCAGTTTATTTCTCGAGAAATAAACTGAGACTGGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_000512.4-1222s21c1
Sequence:CCGGTGGACAGGCCTATCTTCTATTCTCGAGAATAGAAGATAGGCCTGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)