EMAIL THIS PAGE TO A FRIEND

GANC

glucosidase, alpha; neutral C

61 Gene Product Result for
UniProtKB ID: Q8TET4, Q52LQ4, Q8IWZ0, Q8IZM4, Q8IZM5
Gene ID:
Human(2595) Summary: Glycosyl hydrolase enzymes hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. This gene encodes a member of glycosyl hydrolases family 31. This enzyme hydrolyses terminal, non-reducing 1,4-linked alpha-D-glucose residues and releases alpha-D-glucose. This is a key enzyme in glycogen metabolism and its gene localizes to a chromosomal region (15q15) that is associated with susceptibility to diabetes. [provided by RefSeq, Jul 2008]
Mouse(76051) glucosidase, alpha; neutral C
Rat(24382) glucosidase, alpha; neutral C
sheep(101117423) glucosidase, alpha; neutral C
Domestic Rabbit(100343672) glucosidase, alpha; neutral C
naked mole-rat(101707173) glucosidase, alpha; neutral C
domestic guinea pig(100735400) glucosidase, alpha; neutral C
chicken(423232) glucosidase, alpha; neutral C
domestic cat(101081899) glucosidase, alpha; neutral C
cow(530330) glucosidase, alpha; neutral C
Horse(100070973) glucosidase, alpha; neutral C
dog(487517) glucosidase, alpha; neutral C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198141 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219631 MISSION® esiRNA esiRNA targeting human GANC human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198141 Rosetta Predictions human pricing
NM_172672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371675 predicted 1043
2 SASI_Hs01_00058572 predicted 437
3 SASI_Hs01_00058573 predicted 1843
4 SASI_Hs01_00058574 predicted 795
5 SASI_Hs01_00058575 predicted 595
6 SASI_Hs02_00371676 predicted 1458
7 SASI_Hs02_00371677 predicted 1529
8 SASI_Hs01_00058578 predicted 430
9 SASI_Hs01_00058579 predicted 2529
10 SASI_Hs01_00058580 predicted 1815
11 SASI_Hs01_00058571 predicted 1635
12 SASI_Hs01_00058576 predicted 543
13 SASI_Hs01_00058577 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344394 predicted 2275
2 SASI_Mm02_00344395 predicted 1487
3 SASI_Mm02_00344396 predicted 1536
4 SASI_Mm02_00344397 predicted 1894
5 SASI_Mm02_00344398 predicted 2702
6 SASI_Mm02_00344399 predicted 1413
7 SASI_Mm02_00344400 predicted 1508
8 SASI_Mm02_00344401 predicted 3412
9 SASI_Mm02_00344402 predicted 3759
10 SASI_Mm02_00344403 predicted 1316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198141
VALIDATED
GANC MISSION shRNA Bacterial Glycerol Stock
glucosidase, alpha; neutral C
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198141.1-1803s1c1
Sequence:CCGGGCTCCACAACATCTACGGTTTCTCGAGAAACCGTAGATGTTGTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198141.1-253s1c1
Sequence:CCGGGACTGTAACAAGATCGCATTTCTCGAGAAATGCGATCTTGTTACAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198141.1-2217s1c1
Sequence:CCGGGCCATATTGGTATTCTCTGTTCTCGAGAACAGAGAATACCAATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198141.1-1883s1c1
Sequence:CCGGCCTTTGTTCTTACACGTTCTTCTCGAGAAGAACGTGTAAGAACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198141.1-466s1c1
Sequence:CCGGCCCAGATTTGAAGTTCCGGATCTCGAGATCCGGAACTTCAAATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198141.2-3316s21c1
Sequence:CCGGAGCGTTCAGGAGTCTTCTATTCTCGAGAATAGAAGACTCCTGAACGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-1007s21c1
Sequence:CCGGTGCAGAATCACACCAACTTAACTCGAGTTAAGTTGGTGTGATTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-1766s21c1
Sequence:CCGGCAAGGTCAGAGAGTGGTATTCCTCGAGGAATACCACTCTCTGACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-434s21c1
Sequence:CCGGGTCCACCTATCAGGCATTATTCTCGAGAATAATGCCTGATAGGTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198141.2-3251s21c1
Sequence:CCGGACTAACAATATTCCTTGTATCCTCGAGGATACAAGGAATATTGTTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-2602s21c1
Sequence:CCGGCAGTAGCCTTGGACACTATTCCTCGAGGAATAGTGTCCAAGGCTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-1104s21c1
Sequence:CCGGATTTATGGTTCAGTACCTTATCTCGAGATAAGGTACTGAACCATAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-933s21c1
Sequence:CCGGGCTAATGGCCCTTCTTCTATTCTCGAGAATAGAAGAAGGGCCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198141
VALIDATED
GANC MISSION shRNA shRNA Plasmid DNA
glucosidase, alpha; neutral C
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198141.1-1803s1c1
Sequence:CCGGGCTCCACAACATCTACGGTTTCTCGAGAAACCGTAGATGTTGTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198141.1-253s1c1
Sequence:CCGGGACTGTAACAAGATCGCATTTCTCGAGAAATGCGATCTTGTTACAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198141.1-2217s1c1
Sequence:CCGGGCCATATTGGTATTCTCTGTTCTCGAGAACAGAGAATACCAATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198141.1-1883s1c1
Sequence:CCGGCCTTTGTTCTTACACGTTCTTCTCGAGAAGAACGTGTAAGAACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198141.1-466s1c1
Sequence:CCGGCCCAGATTTGAAGTTCCGGATCTCGAGATCCGGAACTTCAAATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198141.2-3316s21c1
Sequence:CCGGAGCGTTCAGGAGTCTTCTATTCTCGAGAATAGAAGACTCCTGAACGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-1007s21c1
Sequence:CCGGTGCAGAATCACACCAACTTAACTCGAGTTAAGTTGGTGTGATTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-1766s21c1
Sequence:CCGGCAAGGTCAGAGAGTGGTATTCCTCGAGGAATACCACTCTCTGACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-434s21c1
Sequence:CCGGGTCCACCTATCAGGCATTATTCTCGAGAATAATGCCTGATAGGTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198141.2-3251s21c1
Sequence:CCGGACTAACAATATTCCTTGTATCCTCGAGGATACAAGGAATATTGTTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-2602s21c1
Sequence:CCGGCAGTAGCCTTGGACACTATTCCTCGAGGAATAGTGTCCAAGGCTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-1104s21c1
Sequence:CCGGATTTATGGTTCAGTACCTTATCTCGAGATAAGGTACTGAACCATAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-933s21c1
Sequence:CCGGGCTAATGGCCCTTCTTCTATTCTCGAGAATAGAAGAAGGGCCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198141
VALIDATED
GANC MISSION shRNA Lentiviral Transduction Particles
glucosidase, alpha; neutral C
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198141.1-1803s1c1
Sequence:CCGGGCTCCACAACATCTACGGTTTCTCGAGAAACCGTAGATGTTGTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198141.1-253s1c1
Sequence:CCGGGACTGTAACAAGATCGCATTTCTCGAGAAATGCGATCTTGTTACAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198141.1-2217s1c1
Sequence:CCGGGCCATATTGGTATTCTCTGTTCTCGAGAACAGAGAATACCAATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198141.1-1883s1c1
Sequence:CCGGCCTTTGTTCTTACACGTTCTTCTCGAGAAGAACGTGTAAGAACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_198141.1-466s1c1
Sequence:CCGGCCCAGATTTGAAGTTCCGGATCTCGAGATCCGGAACTTCAAATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434722    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198141.2-3316s21c1
Sequence:CCGGAGCGTTCAGGAGTCTTCTATTCTCGAGAATAGAAGACTCCTGAACGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-1007s21c1
Sequence:CCGGTGCAGAATCACACCAACTTAACTCGAGTTAAGTTGGTGTGATTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-1766s21c1
Sequence:CCGGCAAGGTCAGAGAGTGGTATTCCTCGAGGAATACCACTCTCTGACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-434s21c1
Sequence:CCGGGTCCACCTATCAGGCATTATTCTCGAGAATAATGCCTGATAGGTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198141.2-3251s21c1
Sequence:CCGGACTAACAATATTCCTTGTATCCTCGAGGATACAAGGAATATTGTTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-2602s21c1
Sequence:CCGGCAGTAGCCTTGGACACTATTCCTCGAGGAATAGTGTCCAAGGCTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-1104s21c1
Sequence:CCGGATTTATGGTTCAGTACCTTATCTCGAGATAAGGTACTGAACCATAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198141.2-933s21c1
Sequence:CCGGGCTAATGGCCCTTCTTCTATTCTCGAGAATAGAAGAAGGGCCATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172672
GANC MISSION shRNA Bacterial Glycerol Stock
glucosidase, alpha; neutral C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172672.2-4101s21c1
Sequence:CCGGTAGACTAGCTTAAGCTATATTCTCGAGAATATAGCTTAAGCTAGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172672.2-1825s21c1
Sequence:CCGGTGCAGAGTCACATCAACTTAACTCGAGTTAAGTTGATGTGACTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172672.2-1858s21c1
Sequence:CCGGTGGAGATGCATACCGTCTTTACTCGAGTAAAGACGGTATGCATCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172672.2-3218s21c1
Sequence:CCGGAGGCCTCTGTGGGTCGAATATCTCGAGATATTCGACCCACAGAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172672.2-3277s21c1
Sequence:CCGGCATGCTGGGAAGCGCTTTATTCTCGAGAATAAAGCGCTTCCCAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172672
GANC MISSION shRNA shRNA Plasmid DNA
glucosidase, alpha; neutral C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172672.2-4101s21c1
Sequence:CCGGTAGACTAGCTTAAGCTATATTCTCGAGAATATAGCTTAAGCTAGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172672.2-1825s21c1
Sequence:CCGGTGCAGAGTCACATCAACTTAACTCGAGTTAAGTTGATGTGACTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172672.2-1858s21c1
Sequence:CCGGTGGAGATGCATACCGTCTTTACTCGAGTAAAGACGGTATGCATCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172672.2-3218s21c1
Sequence:CCGGAGGCCTCTGTGGGTCGAATATCTCGAGATATTCGACCCACAGAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172672.2-3277s21c1
Sequence:CCGGCATGCTGGGAAGCGCTTTATTCTCGAGAATAAAGCGCTTCCCAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172672
GANC MISSION shRNA Lentiviral Transduction Particles
glucosidase, alpha; neutral C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172672.2-4101s21c1
Sequence:CCGGTAGACTAGCTTAAGCTATATTCTCGAGAATATAGCTTAAGCTAGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172672.2-1825s21c1
Sequence:CCGGTGCAGAGTCACATCAACTTAACTCGAGTTAAGTTGATGTGACTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172672.2-1858s21c1
Sequence:CCGGTGGAGATGCATACCGTCTTTACTCGAGTAAAGACGGTATGCATCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172672.2-3218s21c1
Sequence:CCGGAGGCCTCTGTGGGTCGAATATCTCGAGATATTCGACCCACAGAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172672.2-3277s21c1
Sequence:CCGGCATGCTGGGAAGCGCTTTATTCTCGAGAATAAAGCGCTTCCCAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)