EMAIL THIS PAGE TO A FRIEND

GCC1

GRIP and coiled-coil domain containing 1

116 Gene Product Result for
Synonyms: GCC1P GCC88
UniProtKB ID: Q96CN9, Q9H6N7
Gene ID:
Human(79571) Summary: The protein encoded by this gene is a peripheral membrane protein. It is sensitive to brefeldin A. This encoded protein contains a GRIP domain which is thought to be used in targeting. It may play a role in the organization of trans-Golgi network subcompartment involved with membrane transport. [provided by RefSeq, Jul 2008]
Mouse(74375) golgi coiled coil 1
Rat(100361513) GRIP and coiled-coil domain containing 1
sheep(101109438) GRIP and coiled-coil domain containing 1
Domestic Rabbit(100328637) GRIP and coiled-coil domain containing 1
naked mole-rat(101725455) GRIP and coiled-coil domain containing 1
domestic guinea pig(100725863) GRIP and coiled-coil domain containing 1
Zebrafish(445205) GRIP and coiled-coil domain containing 1
chicken(430581) GRIP and coiled-coil domain containing 1
dog(482269) GRIP and coiled-coil domain containing 1
Horse(100056608) GRIP and coiled-coil domain containing 1
cow(539985) GRIP and coiled-coil domain containing 1
domestic cat(101098616) GRIP and coiled-coil domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024523 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024523 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024523 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024523 Rosetta Predictions human pricing
NM_028900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176700 predicted 2357
2 SASI_Hs01_00176701 predicted 2366
3 SASI_Hs01_00176702 predicted 2307
4 SASI_Hs01_00176703 predicted 561
5 SASI_Hs01_00176705 predicted 1101
6 SASI_Hs01_00176706 predicted 2413
7 SASI_Hs02_00356803 predicted 2320
8 SASI_Hs02_00356804 predicted 1696
9 SASI_Hs01_00176708 predicted 455
10 SASI_Hs01_00176709 predicted 1463
11 SASI_Hs01_00176704 predicted 468
12 SASI_Hs01_00176707 predicted 1890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166571 predicted 987
2 SASI_Mm01_00166572 predicted 2689
3 SASI_Mm01_00166574 predicted 1874
4 SASI_Mm01_00166575 predicted 1879
5 SASI_Mm01_00166576 predicted 567
6 SASI_Mm01_00166577 predicted 958
7 SASI_Mm01_00166578 predicted 2767
8 SASI_Mm01_00166579 predicted 1073
9 SASI_Mm01_00166580 predicted 1670
10 SASI_Mm02_00334583 predicted 1317
11 SASI_Mm01_00166573 predicted 2434
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024523
VALIDATED
GCC1 MISSION shRNA Bacterial Glycerol Stock
GRIP and coiled-coil domain containing 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024523.5-901s21c1
Sequence:CCGGGAAGACTCAGTTGGCTACTTTCTCGAGAAAGTAGCCAACTGAGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024523.5-3883s21c1
Sequence:CCGGCCCAACTACTGTTACTGGTTACTCGAGTAACCAGTAACAGTAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024523.5-1478s21c1
Sequence:CCGGCAGCAATCTCAGGTAGAAGAACTCGAGTTCTTCTACCTGAGATTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024523.5-1349s21c1
Sequence:CCGGGATGAGAAGAATCAGCCAGATCTCGAGATCTGGCTGATTCTTCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1475s1c1
Sequence:CCGGCGTCAGCAATCTCAGGTAGAACTCGAGTTCTACCTGAGATTGCTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159007    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024523.5-3272s1c1
Sequence:CCGGGCTAAGGAATAGTGAGTTTATCTCGAGATAAACTCACTATTCCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1262s1c1
Sequence:CCGGGCTGAACAGATGGAAGGATTTCTCGAGAAATCCTTCCATCTGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1349s1c1
Sequence:CCGGGATGAGAAGAATCAGCCAGATCTCGAGATCTGGCTGATTCTTCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024523.5-901s1c1
Sequence:CCGGGAAGACTCAGTTGGCTACTTTCTCGAGAAAGTAGCCAACTGAGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1942s1c1
Sequence:CCGGCAAAGATGGTAACCTGGGAAACTCGAGTTTCCCAGGTTACCATCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1941s1c1
Sequence:CCGGCCAAAGATGGTAACCTGGGAACTCGAGTTCCCAGGTTACCATCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024523.5-2369s1c1
Sequence:CCGGCCCACTTTCTTTCTGTACGCTCTCGAGAGCGTACAGAAAGAAAGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024523.5-3883s1c1
Sequence:CCGGCCCAACTACTGTTACTGGTTACTCGAGTAACCAGTAACAGTAGTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024523.5-1478s1c1
Sequence:CCGGCAGCAATCTCAGGTAGAAGAACTCGAGTTCTTCTACCTGAGATTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-2647s1c1
Sequence:CCGGCACAGCCATACTGACTATCTTCTCGAGAAGATAGTCAGTATGGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024523
VALIDATED
GCC1 MISSION shRNA shRNA Plasmid DNA
GRIP and coiled-coil domain containing 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024523.5-901s21c1
Sequence:CCGGGAAGACTCAGTTGGCTACTTTCTCGAGAAAGTAGCCAACTGAGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024523.5-3883s21c1
Sequence:CCGGCCCAACTACTGTTACTGGTTACTCGAGTAACCAGTAACAGTAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024523.5-1478s21c1
Sequence:CCGGCAGCAATCTCAGGTAGAAGAACTCGAGTTCTTCTACCTGAGATTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024523.5-1349s21c1
Sequence:CCGGGATGAGAAGAATCAGCCAGATCTCGAGATCTGGCTGATTCTTCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1475s1c1
Sequence:CCGGCGTCAGCAATCTCAGGTAGAACTCGAGTTCTACCTGAGATTGCTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159007    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024523.5-3272s1c1
Sequence:CCGGGCTAAGGAATAGTGAGTTTATCTCGAGATAAACTCACTATTCCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1262s1c1
Sequence:CCGGGCTGAACAGATGGAAGGATTTCTCGAGAAATCCTTCCATCTGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1349s1c1
Sequence:CCGGGATGAGAAGAATCAGCCAGATCTCGAGATCTGGCTGATTCTTCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024523.5-901s1c1
Sequence:CCGGGAAGACTCAGTTGGCTACTTTCTCGAGAAAGTAGCCAACTGAGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1942s1c1
Sequence:CCGGCAAAGATGGTAACCTGGGAAACTCGAGTTTCCCAGGTTACCATCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1941s1c1
Sequence:CCGGCCAAAGATGGTAACCTGGGAACTCGAGTTCCCAGGTTACCATCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024523.5-2369s1c1
Sequence:CCGGCCCACTTTCTTTCTGTACGCTCTCGAGAGCGTACAGAAAGAAAGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024523.5-3883s1c1
Sequence:CCGGCCCAACTACTGTTACTGGTTACTCGAGTAACCAGTAACAGTAGTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024523.5-1478s1c1
Sequence:CCGGCAGCAATCTCAGGTAGAAGAACTCGAGTTCTTCTACCTGAGATTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-2647s1c1
Sequence:CCGGCACAGCCATACTGACTATCTTCTCGAGAAGATAGTCAGTATGGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024523
VALIDATED
GCC1 MISSION shRNA Lentiviral Transduction Particles
GRIP and coiled-coil domain containing 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024523.5-901s21c1
Sequence:CCGGGAAGACTCAGTTGGCTACTTTCTCGAGAAAGTAGCCAACTGAGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024523.5-3883s21c1
Sequence:CCGGCCCAACTACTGTTACTGGTTACTCGAGTAACCAGTAACAGTAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024523.5-1478s21c1
Sequence:CCGGCAGCAATCTCAGGTAGAAGAACTCGAGTTCTTCTACCTGAGATTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024523.5-1349s21c1
Sequence:CCGGGATGAGAAGAATCAGCCAGATCTCGAGATCTGGCTGATTCTTCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1475s1c1
Sequence:CCGGCGTCAGCAATCTCAGGTAGAACTCGAGTTCTACCTGAGATTGCTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159007    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024523.5-3272s1c1
Sequence:CCGGGCTAAGGAATAGTGAGTTTATCTCGAGATAAACTCACTATTCCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1262s1c1
Sequence:CCGGGCTGAACAGATGGAAGGATTTCTCGAGAAATCCTTCCATCTGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161218    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1349s1c1
Sequence:CCGGGATGAGAAGAATCAGCCAGATCTCGAGATCTGGCTGATTCTTCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024523.5-901s1c1
Sequence:CCGGGAAGACTCAGTTGGCTACTTTCTCGAGAAAGTAGCCAACTGAGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1942s1c1
Sequence:CCGGCAAAGATGGTAACCTGGGAAACTCGAGTTTCCCAGGTTACCATCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-1941s1c1
Sequence:CCGGCCAAAGATGGTAACCTGGGAACTCGAGTTCCCAGGTTACCATCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024523.5-2369s1c1
Sequence:CCGGCCCACTTTCTTTCTGTACGCTCTCGAGAGCGTACAGAAAGAAAGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162625    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024523.5-3883s1c1
Sequence:CCGGCCCAACTACTGTTACTGGTTACTCGAGTAACCAGTAACAGTAGTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024523.5-1478s1c1
Sequence:CCGGCAGCAATCTCAGGTAGAAGAACTCGAGTTCTTCTACCTGAGATTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024523.5-2647s1c1
Sequence:CCGGCACAGCCATACTGACTATCTTCTCGAGAAGATAGTCAGTATGGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028900
GCC1 MISSION shRNA Bacterial Glycerol Stock
GRIP and coiled-coil domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028900.3-1983s21c1
Sequence:CCGGAGAGCTGAAGGACAAGTATATCTCGAGATATACTTGTCCTTCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028900.3-994s21c1
Sequence:CCGGGACTTAGAGGATGCCAATAAACTCGAGTTTATTGGCATCCTCTAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028900.3-730s21c1
Sequence:CCGGACAAGTGTCAAGGGTGAATTTCTCGAGAAATTCACCCTTGACACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028900.3-517s21c1
Sequence:CCGGGATGTGGTGCGTGCCTATAAACTCGAGTTTATAGGCACGCACCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028900.3-3697s21c1
Sequence:CCGGGATCCTGGCAGAGGTTAATTCCTCGAGGAATTAACCTCTGCCAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028900
GCC1 MISSION shRNA shRNA Plasmid DNA
GRIP and coiled-coil domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028900.3-1983s21c1
Sequence:CCGGAGAGCTGAAGGACAAGTATATCTCGAGATATACTTGTCCTTCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028900.3-994s21c1
Sequence:CCGGGACTTAGAGGATGCCAATAAACTCGAGTTTATTGGCATCCTCTAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028900.3-730s21c1
Sequence:CCGGACAAGTGTCAAGGGTGAATTTCTCGAGAAATTCACCCTTGACACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028900.3-517s21c1
Sequence:CCGGGATGTGGTGCGTGCCTATAAACTCGAGTTTATAGGCACGCACCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028900.3-3697s21c1
Sequence:CCGGGATCCTGGCAGAGGTTAATTCCTCGAGGAATTAACCTCTGCCAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028900
GCC1 MISSION shRNA Lentiviral Transduction Particles
GRIP and coiled-coil domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028900.3-1983s21c1
Sequence:CCGGAGAGCTGAAGGACAAGTATATCTCGAGATATACTTGTCCTTCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028900.3-994s21c1
Sequence:CCGGGACTTAGAGGATGCCAATAAACTCGAGTTTATTGGCATCCTCTAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028900.3-730s21c1
Sequence:CCGGACAAGTGTCAAGGGTGAATTTCTCGAGAAATTCACCCTTGACACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028900.3-517s21c1
Sequence:CCGGGATGTGGTGCGTGCCTATAAACTCGAGTTTATAGGCACGCACCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028900.3-3697s21c1
Sequence:CCGGGATCCTGGCAGAGGTTAATTCCTCGAGGAATTAACCTCTGCCAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)