EMAIL THIS PAGE TO A FRIEND

GDF5

growth differentiation factor 5

53 Gene Product Result for
Synonyms: BDA1C BMP14 CDMP1 LAP4 OS5 SYM1B SYNS2
UniProtKB ID: P43026, E1P5Q2, Q96SB1
Gene ID:
Human(8200) Summary: The protein encoded by this gene is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. Mutations in this gene are associated with acromesomelic dysplasia, Hunter-Thompson type; brachydactyly, type C; and chondrodysplasia, Grebe type. These associations confirm that the gene product plays a role in skeletal development. [provided by RefSeq, Jul 2008]
Mouse(14563) growth differentiation factor 5
Rat(252835) growth differentiation factor 5
Zebrafish(30195) growth differentiation factor 5
chicken(374249) growth differentiation factor 5
dog(485850) growth differentiation factor 5
Horse(100034228) growth differentiation factor 5
cow(539559) growth differentiation factor 5
domestic cat(101081533) growth differentiation factor 5
naked mole-rat(101696976) growth differentiation factor 5
domestic guinea pig(100723808) growth differentiation factor 5
sheep(101116499) growth differentiation factor 5
Domestic Rabbit(100328897) growth differentiation factor 5
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000557 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008109 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008109 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008109 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000557 Rosetta Predictions human pricing
XM_001066344 Rosetta Predictions rat pricing
NM_008109 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243809 predicted 1545
2 SASI_Hs01_00243810 predicted 1431
3 SASI_Hs01_00243811 predicted 2115
4 SASI_Hs01_00243812 predicted 1754
5 SASI_Hs01_00243813 predicted 1731
6 SASI_Hs01_00243814 predicted 1375
7 SASI_Hs01_00243815 predicted 986
8 SASI_Hs01_00243816 predicted 828
9 SASI_Hs01_00243817 predicted 1653
10 SASI_Hs01_00243818 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066344 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317125 predicted 1507
2 SASI_Rn02_00317126 predicted 563
3 SASI_Rn02_00317127 predicted 1397
4 SASI_Rn02_00317128 predicted 1282
5 SASI_Rn02_00317129 predicted 1323
6 SASI_Rn02_00317130 predicted 970
7 SASI_Rn02_00317131 predicted 1742
8 SASI_Rn02_00317132 predicted 1402
9 SASI_Rn02_00317133 predicted 806
10 SASI_Rn02_00317134 predicted 1864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035198 predicted 1641
2 SASI_Mm01_00035199 predicted 1691
3 SASI_Mm01_00035200 predicted 1390
4 SASI_Mm01_00035201 predicted 1886
5 SASI_Mm01_00035202 predicted 862
6 SASI_Mm01_00035203 predicted 1337
7 SASI_Mm01_00035204 predicted 1710
8 SASI_Mm01_00035205 predicted 1743
9 SASI_Mm01_00035206 predicted 1406
10 SASI_Mm01_00035207 predicted 1313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000557
GDF5 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-373s1c1
Sequence:CCGGCCTGGAATTCATCTGCACTGTCTCGAGACAGTGCAGATGAATTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-976s1c1
Sequence:CCGGGCAGAGGTACGTGTTTGACATCTCGAGATGTCAAACACGTACCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-1409s1c1
Sequence:CCGGCAGGACGATAAGACCGTGTATCTCGAGATACACGGTCTTATCGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-1747s1c1
Sequence:CCGGCCTCTTCATTGACTCTGCCAACTCGAGTTGGCAGAGTCAATGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-916s1c1
Sequence:CCGGCAACACCATCACCAGCTTTATCTCGAGATAAAGCTGGTGATGGTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000557.2-1970s21c1
Sequence:CCGGTGAGTGTGACTTGGGCTAAAGCTCGAGCTTTAGCCCAAGTCACACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000557.2-2119s21c1
Sequence:CCGGATGAGACTCAGCCCACCATTTCTCGAGAAATGGTGGGCTGAGTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000557.2-880s21c1
Sequence:CCGGAGGCAACAGCAGCGTGAAGTTCTCGAGAACTTCACGCTGCTGTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000557
GDF5 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-373s1c1
Sequence:CCGGCCTGGAATTCATCTGCACTGTCTCGAGACAGTGCAGATGAATTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-976s1c1
Sequence:CCGGGCAGAGGTACGTGTTTGACATCTCGAGATGTCAAACACGTACCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-1409s1c1
Sequence:CCGGCAGGACGATAAGACCGTGTATCTCGAGATACACGGTCTTATCGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-1747s1c1
Sequence:CCGGCCTCTTCATTGACTCTGCCAACTCGAGTTGGCAGAGTCAATGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-916s1c1
Sequence:CCGGCAACACCATCACCAGCTTTATCTCGAGATAAAGCTGGTGATGGTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000557.2-1970s21c1
Sequence:CCGGTGAGTGTGACTTGGGCTAAAGCTCGAGCTTTAGCCCAAGTCACACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000557.2-2119s21c1
Sequence:CCGGATGAGACTCAGCCCACCATTTCTCGAGAAATGGTGGGCTGAGTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000557.2-880s21c1
Sequence:CCGGAGGCAACAGCAGCGTGAAGTTCTCGAGAACTTCACGCTGCTGTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000557
GDF5 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-373s1c1
Sequence:CCGGCCTGGAATTCATCTGCACTGTCTCGAGACAGTGCAGATGAATTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-976s1c1
Sequence:CCGGGCAGAGGTACGTGTTTGACATCTCGAGATGTCAAACACGTACCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-1409s1c1
Sequence:CCGGCAGGACGATAAGACCGTGTATCTCGAGATACACGGTCTTATCGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-1747s1c1
Sequence:CCGGCCTCTTCATTGACTCTGCCAACTCGAGTTGGCAGAGTCAATGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000557.2-916s1c1
Sequence:CCGGCAACACCATCACCAGCTTTATCTCGAGATAAAGCTGGTGATGGTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000557.2-1970s21c1
Sequence:CCGGTGAGTGTGACTTGGGCTAAAGCTCGAGCTTTAGCCCAAGTCACACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000557.2-2119s21c1
Sequence:CCGGATGAGACTCAGCCCACCATTTCTCGAGAAATGGTGGGCTGAGTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000557.2-880s21c1
Sequence:CCGGAGGCAACAGCAGCGTGAAGTTCTCGAGAACTTCACGCTGCTGTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008109
GDF5 MISSION shRNA Bacterial Glycerol Stock
growth differentiation factor 5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008109.1-2028s1c1
Sequence:CCGGGCTCAGGAAAGGTGTTCTTAACTCGAGTTAAGAACACCTTTCCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008109.1-1747s1c1
Sequence:CCGGGCCAACAACGTGGTGTATAAACTCGAGTTTATACACCACGTTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008109.1-1641s1c1
Sequence:CCGGCGCAGTCATTCAGACCCTAATCTCGAGATTAGGGTCTGAATGACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008109.1-1329s1c1
Sequence:CCGGCCTAGTGTTTGGTCGTACCAACTCGAGTTGGTACGACCAAACACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008109.1-969s1c1
Sequence:CCGGCGTGTTTGACATCAGTGCCTTCTCGAGAAGGCACTGATGTCAAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008109.2-1942s21c1
Sequence:CCGGTGGATGTGATCTGGACTAAAGCTCGAGCTTTAGTCCAGATCACATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008109.2-2107s21c1
Sequence:CCGGAGCTATATCCTAAGCTCTTTACTCGAGTAAAGAGCTTAGGATATAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008109
GDF5 MISSION shRNA shRNA Plasmid DNA
growth differentiation factor 5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008109.1-2028s1c1
Sequence:CCGGGCTCAGGAAAGGTGTTCTTAACTCGAGTTAAGAACACCTTTCCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008109.1-1747s1c1
Sequence:CCGGGCCAACAACGTGGTGTATAAACTCGAGTTTATACACCACGTTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008109.1-1641s1c1
Sequence:CCGGCGCAGTCATTCAGACCCTAATCTCGAGATTAGGGTCTGAATGACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008109.1-1329s1c1
Sequence:CCGGCCTAGTGTTTGGTCGTACCAACTCGAGTTGGTACGACCAAACACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008109.1-969s1c1
Sequence:CCGGCGTGTTTGACATCAGTGCCTTCTCGAGAAGGCACTGATGTCAAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008109.2-1942s21c1
Sequence:CCGGTGGATGTGATCTGGACTAAAGCTCGAGCTTTAGTCCAGATCACATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008109.2-2107s21c1
Sequence:CCGGAGCTATATCCTAAGCTCTTTACTCGAGTAAAGAGCTTAGGATATAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008109
GDF5 MISSION shRNA Lentiviral Transduction Particles
growth differentiation factor 5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008109.1-2028s1c1
Sequence:CCGGGCTCAGGAAAGGTGTTCTTAACTCGAGTTAAGAACACCTTTCCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008109.1-1747s1c1
Sequence:CCGGGCCAACAACGTGGTGTATAAACTCGAGTTTATACACCACGTTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008109.1-1641s1c1
Sequence:CCGGCGCAGTCATTCAGACCCTAATCTCGAGATTAGGGTCTGAATGACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008109.1-1329s1c1
Sequence:CCGGCCTAGTGTTTGGTCGTACCAACTCGAGTTGGTACGACCAAACACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008109.1-969s1c1
Sequence:CCGGCGTGTTTGACATCAGTGCCTTCTCGAGAAGGCACTGATGTCAAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414909    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008109.2-1942s21c1
Sequence:CCGGTGGATGTGATCTGGACTAAAGCTCGAGCTTTAGTCCAGATCACATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008109.2-2107s21c1
Sequence:CCGGAGCTATATCCTAAGCTCTTTACTCGAGTAAAGAGCTTAGGATATAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)