EMAIL THIS PAGE TO A FRIEND

GFM1

G elongation factor, mitochondrial 1

125 Gene Product Result for
Synonyms: COXPD1 EFG EFG1 EFGM EGF1 GFM hEFG1
UniProtKB ID: Q96RP9, A6NCI9, B2RCB9, B3KRW1, Q6GTN2, Q96T39
Gene ID:
Human(85476) Summary: Eukaryotes contain two protein translational systems, one in the cytoplasm and one in the mitochondria. Mitochondrial translation is crucial for maintaining mitochondrial function and mutations in this system lead to a breakdown in the respiratory chain-oxidative phosphorylation system and to impaired maintenance of mitochondrial DNA. This gene encodes one of the mitochondrial translation elongation factors. Its role in the regulation of normal mitochondrial function and in different disease states attributed to mitochondrial dysfunction is not known. [provided by RefSeq, Jul 2008]
Mouse(28030) G elongation factor, mitochondrial 1
Rat(114017) G elongation factor, mitochondrial 1
Zebrafish(561840) G elongation factor, mitochondrial 1
cow(513309) G elongation factor, mitochondrial 1
Horse(100055837) G elongation factor, mitochondrial 1
chicken(425018) G elongation factor, mitochondrial 1
dog(477128) G elongation factor, mitochondrial 1
domestic cat(101094694) G elongation factor, mitochondrial 1
sheep(101119786) G elongation factor, mitochondrial 1
naked mole-rat(101697641) G elongation factor, mitochondrial 1
domestic guinea pig(100727884) G elongation factor, mitochondrial 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024996 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024996 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024996 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024996 Rosetta Predictions human pricing
NM_053625 Rosetta Predictions rat pricing
XM_579567 Rosetta Predictions rat pricing
NM_138591 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357648 predicted 1999 154.00
2 SASI_Hs01_00072471 predicted 590 154.00
3 SASI_Hs02_00357649 predicted 1216 154.00
4 SASI_Hs01_00072472 predicted 692 154.00
5 SASI_Hs02_00357650 predicted 1812 154.00
6 SASI_Hs01_00072475 predicted 1511 154.00
7 SASI_Hs01_00072476 predicted 810 154.00
8 SASI_Hs01_00072477 predicted 2276 154.00
9 SASI_Hs01_00072478 predicted 2239 154.00
10 SASI_Hs02_00357651 predicted 878 154.00
11 SASI_Hs01_00072470 predicted 1198 154.00
12 SASI_Hs01_00072473 predicted 859 154.00
13 SASI_Hs01_00072474 predicted 2260 154.00
14 SASI_Hs01_00072479 predicted 1377 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103126 predicted 1231 154.00
2 SASI_Rn01_00103127 predicted 2314 154.00
3 SASI_Rn01_00103128 predicted 1591 154.00
4 SASI_Rn01_00103129 predicted 1239 154.00
5 SASI_Rn02_00266332 predicted 1527 154.00
6 SASI_Rn01_00103130 predicted 1487 154.00
7 SASI_Rn01_00103131 predicted 738 154.00
8 SASI_Rn01_00103132 predicted 2167 154.00
9 SASI_Rn01_00103133 predicted 707 154.00
10 SASI_Rn01_00103134 predicted 2151 154.00
11 SASI_Rn01_00103135 predicted 1880 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172388 predicted 323 154.00
2 SASI_Rn01_00172389 predicted 468 154.00
3 SASI_Rn01_00172390 predicted 591 154.00
4 SASI_Rn01_00172391 predicted 422 154.00
5 SASI_Rn01_00172392 predicted 465 154.00
6 SASI_Rn01_00172393 predicted 353 154.00
7 SASI_Rn01_00172394 predicted 309 154.00
8 SASI_Rn01_00172395 predicted 365 154.00
9 SASI_Rn01_00172396 predicted 470 154.00
10 SASI_Rn01_00172397 predicted 1367 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181118 predicted 1095 154.00
2 SASI_Mm01_00181119 predicted 684 154.00
3 SASI_Mm01_00181120 predicted 759 154.00
4 SASI_Mm01_00181121 predicted 1480 154.00
5 SASI_Mm01_00181122 predicted 771 154.00
6 SASI_Mm01_00181123 predicted 1375 154.00
7 SASI_Mm01_00181124 predicted 1518 154.00
8 SASI_Mm01_00181125 predicted 1590 154.00
9 SASI_Mm02_00339656 predicted 1389 154.00
10 SASI_Mm01_00181126 predicted 1034 154.00
11 SASI_Mm01_00181117 predicted 700 154.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024996
VALIDATED
GFM1 MISSION shRNA Bacterial Glycerol Stock
G elongation factor, mitochondrial 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024996.5-1076s1c1
Sequence:CCGGCCAGAACTATGCTATTCTCAACTCGAGTTGAGAATAGCATAGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024996.5-256s1c1
Sequence:CCGGGAATCTCAGCTCACATTGATTCTCGAGAATCAATGTGAGCTGAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024996.5-1645s1c1
Sequence:CCGGGCTGTCCTTGTATCACAGGAACTCGAGTTCCTGTGATACAAGGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024996.5-2881s1c1
Sequence:CCGGGCTGAAGACTTGAAAGTGAATCTCGAGATTCACTTTCAAGTCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024996.5-1816s1c1
Sequence:CCGGCAGATGAAACATTCGGATCAACTCGAGTTGATCCGAATGTTTCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-598s1c1
Sequence:CCGGGCTACAACGTTCCGTTTCTAACTCGAGTTAGAAACGGAACGTTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-2284s1c1
Sequence:CCGGCCACACAAGAAGACGTCATTACTCGAGTAATGACGTCTTCTTGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-264s1c1
Sequence:CCGGGCTCACATTGATTCTGGGAAACTCGAGTTTCCCAGAATCAATGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-2782s1c1
Sequence:CCGGCCTTTGTTAACGGGTTGTTTACTCGAGTAAACAACCCGTTAACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-863s1c1
Sequence:CCGGGCTAATTGAATGTGTTGCCAACTCGAGTTGGCAACACATTCAATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024996
VALIDATED
GFM1 MISSION shRNA shRNA Plasmid DNA
G elongation factor, mitochondrial 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024996.5-1076s1c1
Sequence:CCGGCCAGAACTATGCTATTCTCAACTCGAGTTGAGAATAGCATAGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024996.5-256s1c1
Sequence:CCGGGAATCTCAGCTCACATTGATTCTCGAGAATCAATGTGAGCTGAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024996.5-1645s1c1
Sequence:CCGGGCTGTCCTTGTATCACAGGAACTCGAGTTCCTGTGATACAAGGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024996.5-2881s1c1
Sequence:CCGGGCTGAAGACTTGAAAGTGAATCTCGAGATTCACTTTCAAGTCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024996.5-1816s1c1
Sequence:CCGGCAGATGAAACATTCGGATCAACTCGAGTTGATCCGAATGTTTCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-598s1c1
Sequence:CCGGGCTACAACGTTCCGTTTCTAACTCGAGTTAGAAACGGAACGTTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-2284s1c1
Sequence:CCGGCCACACAAGAAGACGTCATTACTCGAGTAATGACGTCTTCTTGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-264s1c1
Sequence:CCGGGCTCACATTGATTCTGGGAAACTCGAGTTTCCCAGAATCAATGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-2782s1c1
Sequence:CCGGCCTTTGTTAACGGGTTGTTTACTCGAGTAAACAACCCGTTAACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-863s1c1
Sequence:CCGGGCTAATTGAATGTGTTGCCAACTCGAGTTGGCAACACATTCAATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024996
VALIDATED
GFM1 MISSION shRNA Lentiviral Transduction Particles
G elongation factor, mitochondrial 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024996.5-1076s1c1
Sequence:CCGGCCAGAACTATGCTATTCTCAACTCGAGTTGAGAATAGCATAGTTCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000145416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024996.5-256s1c1
Sequence:CCGGGAATCTCAGCTCACATTGATTCTCGAGAATCAATGTGAGCTGAGATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000139872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024996.5-1645s1c1
Sequence:CCGGGCTGTCCTTGTATCACAGGAACTCGAGTTCCTGTGATACAAGGACAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000145005    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024996.5-2881s1c1
Sequence:CCGGGCTGAAGACTTGAAAGTGAATCTCGAGATTCACTTTCAAGTCTTCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000144519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024996.5-1816s1c1
Sequence:CCGGCAGATGAAACATTCGGATCAACTCGAGTTGATCCGAATGTTTCATCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000142606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-598s1c1
Sequence:CCGGGCTACAACGTTCCGTTTCTAACTCGAGTTAGAAACGGAACGTTGTAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000141319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-2284s1c1
Sequence:CCGGCCACACAAGAAGACGTCATTACTCGAGTAATGACGTCTTCTTGTGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000141810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-264s1c1
Sequence:CCGGGCTCACATTGATTCTGGGAAACTCGAGTTTCCCAGAATCAATGTGAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000144179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-2782s1c1
Sequence:CCGGCCTTTGTTAACGGGTTGTTTACTCGAGTAAACAACCCGTTAACAAAGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000144593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_024996.5-863s1c1
Sequence:CCGGGCTAATTGAATGTGTTGCCAACTCGAGTTGGCAACACATTCAATTAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138591
VALIDATED
GFM1 MISSION shRNA Bacterial Glycerol Stock
G elongation factor, mitochondrial 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138591.2-2054s21c1
Sequence:CCGGTGTATTATTGAGCCTATTATGCTCGAGCATAATAGGCTCAATAATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138591.2-822s21c1
Sequence:CCGGTTGTCCGATATGACGAGATTCCTCGAGGAATCTCGTCATATCGGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138591.1-1527s1c1
Sequence:CCGGCCAAAGGTATTGGCAGGTTTACTCGAGTAAACCTGCCAATACCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138591.2-1225s21c1
Sequence:CCGGGCTGACTTATGTCCGAAATTACTCGAGTAATTTCGGACATAAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138591.2-2391s21c1
Sequence:CCGGTCAGGATATACTGACTATTTGCTCGAGCAAATAGTCAGTATATCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138591.2-778s21c1
Sequence:CCGGCATTGAAGAACGAGCTATTTACTCGAGTAAATAGCTCGTTCTTCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138591.1-1229s1c1
Sequence:CCGGCTGACTTATGTCCGAAATTATCTCGAGATAATTTCGGACATAAGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138591.1-1694s1c1
Sequence:CCGGGTAGCCTTTAGAGAGACCATTCTCGAGAATGGTCTCTCTAAAGGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138591.2-778s1c1
Sequence:CCGGCATTGAAGAACGAGCTATTTACTCGAGTAAATAGCTCGTTCTTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138591
VALIDATED
GFM1 MISSION shRNA shRNA Plasmid DNA
G elongation factor, mitochondrial 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138591.2-2054s21c1
Sequence:CCGGTGTATTATTGAGCCTATTATGCTCGAGCATAATAGGCTCAATAATACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138591.2-822s21c1
Sequence:CCGGTTGTCCGATATGACGAGATTCCTCGAGGAATCTCGTCATATCGGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138591.1-1527s1c1
Sequence:CCGGCCAAAGGTATTGGCAGGTTTACTCGAGTAAACCTGCCAATACCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138591.2-1225s21c1
Sequence:CCGGGCTGACTTATGTCCGAAATTACTCGAGTAATTTCGGACATAAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138591.2-2391s21c1
Sequence:CCGGTCAGGATATACTGACTATTTGCTCGAGCAAATAGTCAGTATATCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138591.2-778s21c1
Sequence:CCGGCATTGAAGAACGAGCTATTTACTCGAGTAAATAGCTCGTTCTTCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138591.1-1229s1c1
Sequence:CCGGCTGACTTATGTCCGAAATTATCTCGAGATAATTTCGGACATAAGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138591.1-1694s1c1
Sequence:CCGGGTAGCCTTTAGAGAGACCATTCTCGAGAATGGTCTCTCTAAAGGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138591.2-778s1c1
Sequence:CCGGCATTGAAGAACGAGCTATTTACTCGAGTAAATAGCTCGTTCTTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138591
VALIDATED
GFM1 MISSION shRNA Lentiviral Transduction Particles
G elongation factor, mitochondrial 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138591.2-2054s21c1
Sequence:CCGGTGTATTATTGAGCCTATTATGCTCGAGCATAATAGGCTCAATAATACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138591.2-822s21c1
Sequence:CCGGTTGTCCGATATGACGAGATTCCTCGAGGAATCTCGTCATATCGGACAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000179814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138591.1-1527s1c1
Sequence:CCGGCCAAAGGTATTGGCAGGTTTACTCGAGTAAACCTGCCAATACCTTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138591.2-1225s21c1
Sequence:CCGGGCTGACTTATGTCCGAAATTACTCGAGTAATTTCGGACATAAGTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138591.2-2391s21c1
Sequence:CCGGTCAGGATATACTGACTATTTGCTCGAGCAAATAGTCAGTATATCCTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000248333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138591.2-778s21c1
Sequence:CCGGCATTGAAGAACGAGCTATTTACTCGAGTAAATAGCTCGTTCTTCAATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138591.1-1229s1c1
Sequence:CCGGCTGACTTATGTCCGAAATTATCTCGAGATAATTTCGGACATAAGTCAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000179402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138591.1-1694s1c1
Sequence:CCGGGTAGCCTTTAGAGAGACCATTCTCGAGAATGGTCTCTCTAAAGGCTACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000215910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138591.2-778s1c1
Sequence:CCGGCATTGAAGAACGAGCTATTTACTCGAGTAAATAGCTCGTTCTTCAATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???