EMAIL THIS PAGE TO A FRIEND

GFRA1

GDNF family receptor alpha 1

107 Gene Product Result for
Synonyms: GDNFR GDNFRA GFR-ALPHA-1 RET1L RETL1 TRNR1
UniProtKB ID: P56159, A8KA21, O15507, O43912
Gene ID:
Human(2674) Summary: Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. The protein encoded by this gene is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. This gene is a candidate gene for Hirschsprung disease. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Feb 2009]
Mouse(14585) glial cell line derived neurotrophic factor family receptor alpha 1
Rat(25454) GDNF family receptor alpha 1
chicken(395994) GDNF family receptor alpha 1
domestic cat(101085242) GDNF family receptor alpha 1
dog(609114) GDNF family receptor alpha 1
cow(534801) GDNF family receptor alpha 1
sheep(101120125) GDNF family receptor alpha 1
naked mole-rat(101699880) GDNF family receptor alpha 1
domestic guinea pig(100720930) GDNF family receptor alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005264 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070521 MISSION® esiRNA esiRNA human GFRA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005264 Rosetta Predictions human pricing
NM_145793 Rosetta Predictions human pricing
NM_012959 Rosetta Predictions rat pricing
NM_010279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127887 predicted 1766
2 SASI_Hs02_00339299 predicted 1287
3 SASI_Hs01_00127888 predicted 1312
4 SASI_Hs01_00127890 predicted 668
5 SASI_Hs01_00127891 predicted 1695
6 SASI_Hs01_00127892 predicted 1257
7 SASI_Hs02_00339300 predicted 1314
8 SASI_Hs01_00127893 predicted 1217
9 SASI_Hs01_00127894 predicted 1777
10 SASI_Hs01_00127895 predicted 625
11 SASI_Hs01_00127889 predicted 1359
12 SASI_Hs01_00127896 predicted 1749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089691 predicted 1456
2 SASI_Hs02_00365354 predicted 980
3 SASI_Hs01_00089692 predicted 996
4 SASI_Hs01_00089694 predicted 380
5 SASI_Hs01_00089695 predicted 1380
6 SASI_Hs01_00089696 predicted 949
7 SASI_Hs02_00365355 predicted 1001
8 SASI_Hs01_00089697 predicted 906
9 SASI_Hs01_00089698 predicted 1468
10 SASI_Hs01_00089699 predicted 337
11 SASI_Hs01_00089693 predicted 1051
12 SASI_Hs01_00089700 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048555 predicted 1246
2 SASI_Rn01_00048556 predicted 1127
3 SASI_Rn01_00048557 predicted 1277
4 SASI_Rn01_00048558 predicted 419
5 SASI_Rn01_00048559 predicted 1127
6 SASI_Rn02_00260561 predicted 688
7 SASI_Rn01_00048560 predicted 552
8 SASI_Rn01_00048561 predicted 1468
9 SASI_Rn01_00048562 predicted 1268
10 SASI_Rn01_00048563 predicted 1056
11 SASI_Rn01_00048564 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318208 predicted 1614
2 SASI_Mm02_00318209 predicted 282
3 SASI_Mm02_00318210 predicted 985
4 SASI_Mm02_00318211 predicted 1265
5 SASI_Mm02_00318212 predicted 999
6 SASI_Mm02_00318213 predicted 551
7 SASI_Mm02_00318214 predicted 417
8 SASI_Mm02_00318215 predicted 194
9 SASI_Mm02_00318216 predicted 852
10 SASI_Mm02_00318217 predicted 1327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010279
VALIDATED
GFRA1 MISSION shRNA Bacterial Glycerol Stock
GDNF family receptor alpha 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010279.2-1344s1c1
Sequence:CCGGGCAGTACACATCTCTGTCTTTCTCGAGAAAGACAGAGATGTGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010279.2-1497s1c1
Sequence:CCGGTGTCTGTATCATTGGCAGAAACTCGAGTTTCTGCCAATGATACAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010279.2-1997s1c1
Sequence:CCGGGCAGACTCTATCTTGTACTAACTCGAGTTAGTACAAGATAGAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010279.2-355s1c1
Sequence:CCGGGAAGCAGAAGTCTCTCTACAACTCGAGTTGTAGAGAGACTTCTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010279.2-518s1c1
Sequence:CCGGGCAGTCCCGTTCATATCAGATCTCGAGATCTGATATGAACGGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010279.2-355s21c1
Sequence:CCGGGAAGCAGAAGTCTCTCTACAACTCGAGTTGTAGAGAGACTTCTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010279.2-1895s21c1
Sequence:CCGGAGATTCTTCCGGATCTTATTTCTCGAGAAATAAGATCCGGAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010279.2-518s21c1
Sequence:CCGGGCAGTCCCGTTCATATCAGATCTCGAGATCTGATATGAACGGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010279.2-1292s21c1
Sequence:CCGGTTACCACCGTGTGCTAATTTGCTCGAGCAAATTAGCACACGGTGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010279.2-886s21c1
Sequence:CCGGCAGATCTCGCCTTGCAGATTTCTCGAGAAATCTGCAAGGCGAGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010279
VALIDATED
GFRA1 MISSION shRNA shRNA Plasmid DNA
GDNF family receptor alpha 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010279.2-1344s1c1
Sequence:CCGGGCAGTACACATCTCTGTCTTTCTCGAGAAAGACAGAGATGTGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010279.2-1497s1c1
Sequence:CCGGTGTCTGTATCATTGGCAGAAACTCGAGTTTCTGCCAATGATACAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010279.2-1997s1c1
Sequence:CCGGGCAGACTCTATCTTGTACTAACTCGAGTTAGTACAAGATAGAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010279.2-355s1c1
Sequence:CCGGGAAGCAGAAGTCTCTCTACAACTCGAGTTGTAGAGAGACTTCTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010279.2-518s1c1
Sequence:CCGGGCAGTCCCGTTCATATCAGATCTCGAGATCTGATATGAACGGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010279.2-355s21c1
Sequence:CCGGGAAGCAGAAGTCTCTCTACAACTCGAGTTGTAGAGAGACTTCTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010279.2-1895s21c1
Sequence:CCGGAGATTCTTCCGGATCTTATTTCTCGAGAAATAAGATCCGGAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010279.2-518s21c1
Sequence:CCGGGCAGTCCCGTTCATATCAGATCTCGAGATCTGATATGAACGGGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010279.2-1292s21c1
Sequence:CCGGTTACCACCGTGTGCTAATTTGCTCGAGCAAATTAGCACACGGTGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010279.2-886s21c1
Sequence:CCGGCAGATCTCGCCTTGCAGATTTCTCGAGAAATCTGCAAGGCGAGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010279
VALIDATED
GFRA1 MISSION shRNA Lentiviral Transduction Particles
GDNF family receptor alpha 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010279.2-1344s1c1
Sequence:CCGGGCAGTACACATCTCTGTCTTTCTCGAGAAAGACAGAGATGTGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010279.2-1497s1c1
Sequence:CCGGTGTCTGTATCATTGGCAGAAACTCGAGTTTCTGCCAATGATACAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010279.2-1997s1c1
Sequence:CCGGGCAGACTCTATCTTGTACTAACTCGAGTTAGTACAAGATAGAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010279.2-355s1c1
Sequence:CCGGGAAGCAGAAGTCTCTCTACAACTCGAGTTGTAGAGAGACTTCTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010279.2-518s1c1
Sequence:CCGGGCAGTCCCGTTCATATCAGATCTCGAGATCTGATATGAACGGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010279.2-355s21c1
Sequence:CCGGGAAGCAGAAGTCTCTCTACAACTCGAGTTGTAGAGAGACTTCTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010279.2-1895s21c1
Sequence:CCGGAGATTCTTCCGGATCTTATTTCTCGAGAAATAAGATCCGGAAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010279.2-518s21c1
Sequence:CCGGGCAGTCCCGTTCATATCAGATCTCGAGATCTGATATGAACGGGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010279.2-1292s21c1
Sequence:CCGGTTACCACCGTGTGCTAATTTGCTCGAGCAAATTAGCACACGGTGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010279.2-886s21c1
Sequence:CCGGCAGATCTCGCCTTGCAGATTTCTCGAGAAATCTGCAAGGCGAGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005264
VALIDATED
GFRA1 MISSION shRNA Bacterial Glycerol Stock
GDNF family receptor alpha 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005264.2-1785s1c1
Sequence:CCGGCCTCTGTATTTCCAATGGTAACTCGAGTTACCATTGGAAATACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005264.2-1038s1c1
Sequence:CCGGCGACGACATTTGCAAGAAGTACTCGAGTACTTCTTGCAAATGTCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005264.2-1690s1c1
Sequence:CCGGGCAGGGTCTGAGAATGAAATTCTCGAGAATTTCATTCTCAGACCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005264.2-1445s1c1
Sequence:CCGGCCAACTACATAGACTCCAGTACTCGAGTACTGGAGTCTATGTAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005264.2-849s1c1
Sequence:CCGGGCGCATTTACTGGAGCATGTACTCGAGTACATGCTCCAGTAAATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005264
VALIDATED
GFRA1 MISSION shRNA shRNA Plasmid DNA
GDNF family receptor alpha 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005264.2-1785s1c1
Sequence:CCGGCCTCTGTATTTCCAATGGTAACTCGAGTTACCATTGGAAATACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005264.2-1038s1c1
Sequence:CCGGCGACGACATTTGCAAGAAGTACTCGAGTACTTCTTGCAAATGTCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005264.2-1690s1c1
Sequence:CCGGGCAGGGTCTGAGAATGAAATTCTCGAGAATTTCATTCTCAGACCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005264.2-1445s1c1
Sequence:CCGGCCAACTACATAGACTCCAGTACTCGAGTACTGGAGTCTATGTAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005264.2-849s1c1
Sequence:CCGGGCGCATTTACTGGAGCATGTACTCGAGTACATGCTCCAGTAAATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005264
VALIDATED
GFRA1 MISSION shRNA Lentiviral Transduction Particles
GDNF family receptor alpha 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005264.2-1785s1c1
Sequence:CCGGCCTCTGTATTTCCAATGGTAACTCGAGTTACCATTGGAAATACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005264.2-1038s1c1
Sequence:CCGGCGACGACATTTGCAAGAAGTACTCGAGTACTTCTTGCAAATGTCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005264.2-1690s1c1
Sequence:CCGGGCAGGGTCTGAGAATGAAATTCTCGAGAATTTCATTCTCAGACCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005264.2-1445s1c1
Sequence:CCGGCCAACTACATAGACTCCAGTACTCGAGTACTGGAGTCTATGTAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005264.2-849s1c1
Sequence:CCGGGCGCATTTACTGGAGCATGTACTCGAGTACATGCTCCAGTAAATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)