EMAIL THIS PAGE TO A FRIEND

GGTA1

23 Gene Product Result for
Gene ID:
Rat(652927) ABO-family member 5
dog(491357) glycoprotein galactosyltransferase alpha 1, 3
domestic cat(493877) alpha-1,3-galactosyltransferase
cow(281780) alpha-galactosyltransferase 1 (glycoprotein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010283 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010283 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010283 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU087591 MISSION® esiRNA targeting mouse Ggta1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037583 Rosetta Predictions rat pricing
NM_010283 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080983 predicted 494
2 SASI_Rn01_00080984 predicted 624
3 SASI_Rn01_00080985 predicted 473
4 SASI_Rn02_00204506 predicted 686
5 SASI_Rn01_00080986 predicted 281
6 SASI_Rn01_00080987 predicted 700
7 SASI_Rn01_00080988 predicted 327
8 SASI_Rn01_00080989 predicted 469
9 SASI_Rn01_00080990 predicted 450
10 SASI_Rn02_00204507 predicted 453
11 SASI_Rn01_00080982 predicted 658
12 SASI_Rn01_00080991 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010283 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197073 predicted 1372
2 SASI_Mm01_00197074 predicted 665
3 SASI_Mm01_00197075 predicted 1581
4 SASI_Mm01_00197076 predicted 1501
5 SASI_Mm01_00197077 predicted 1605
6 SASI_Mm01_00197078 predicted 1018
7 SASI_Mm01_00197079 predicted 692
8 SASI_Mm01_00197080 predicted 987
9 SASI_Mm01_00197081 predicted 1195
10 SASI_Mm01_00197082 predicted 1241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010283
GGTA1 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010283.1-2402s1c1
Sequence:CCGGCCCTATTATATCAGAAGACAACTCGAGTTGTCTTCTGATATAATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010283.1-990s1c1
Sequence:CCGGCCCTCTACATTCCTTACAAGTCTCGAGACTTGTAAGGAATGTAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010283.1-874s1c1
Sequence:CCGGGAGCATTACTTAGAAGACTTTCTCGAGAAAGTCTTCTAAGTAATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010283.1-1456s1c1
Sequence:CCGGCCAGAGTATTGCTGGGACTATCTCGAGATAGTCCCAGCAATACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010283.1-630s1c1
Sequence:CCGGCCACAGTTATCAAGAAGACAACTCGAGTTGTCTTCTTGATAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010283
GGTA1 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010283.1-2402s1c1
Sequence:CCGGCCCTATTATATCAGAAGACAACTCGAGTTGTCTTCTGATATAATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010283.1-990s1c1
Sequence:CCGGCCCTCTACATTCCTTACAAGTCTCGAGACTTGTAAGGAATGTAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010283.1-874s1c1
Sequence:CCGGGAGCATTACTTAGAAGACTTTCTCGAGAAAGTCTTCTAAGTAATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010283.1-1456s1c1
Sequence:CCGGCCAGAGTATTGCTGGGACTATCTCGAGATAGTCCCAGCAATACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010283.1-630s1c1
Sequence:CCGGCCACAGTTATCAAGAAGACAACTCGAGTTGTCTTCTTGATAACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010283
GGTA1 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093904    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010283.1-2402s1c1
Sequence:CCGGCCCTATTATATCAGAAGACAACTCGAGTTGTCTTCTGATATAATAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000093907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010283.1-990s1c1
Sequence:CCGGCCCTCTACATTCCTTACAAGTCTCGAGACTTGTAAGGAATGTAGAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000093908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010283.1-874s1c1
Sequence:CCGGGAGCATTACTTAGAAGACTTTCTCGAGAAAGTCTTCTAAGTAATGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000093905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010283.1-1456s1c1
Sequence:CCGGCCAGAGTATTGCTGGGACTATCTCGAGATAGTCCCAGCAATACTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000093906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010283.1-630s1c1
Sequence:CCGGCCACAGTTATCAAGAAGACAACTCGAGTTGTCTTCTTGATAACTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???