EMAIL THIS PAGE TO A FRIEND

GIGYF1

GRB10 interacting GYF protein 1

219 Gene Product Result for
Synonyms: GYF1 PERQ1
UniProtKB ID: O75420, Q6Y7W7, Q8WZ38
Gene ID:
Mouse(57330) GRB10 interacting GYF protein 1
Rat(304378) GRB10 interacting GYF protein 1
dog(489833) GRB10 interacting GYF protein 1
domestic cat(101093567) GRB10 interacting GYF protein 1
Horse(100067506) GRB10 interacting GYF protein 1
cow(532406) GRB10 interacting GYF protein 1
sheep(101102611) GRB10 interacting GYF protein 1
Domestic Rabbit(100341602) GRB10 interacting GYF protein 1
naked mole-rat(101710640) GRB10 interacting GYF protein 1
domestic guinea pig(100715886) GRB10 interacting GYF protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022574 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022574 Rosetta Predictions human pricing
NM_001107133 Rosetta Predictions rat pricing
NM_031408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088979 predicted 1088
2 SASI_Hs01_00088980 predicted 2019
3 SASI_Hs02_00355876 predicted 2022
4 SASI_Hs01_00088981 predicted 1123
5 SASI_Hs01_00088982 predicted 3806
6 SASI_Hs01_00088983 predicted 2986
7 SASI_Hs01_00088984 predicted 1267
8 SASI_Hs02_00355877 predicted 1121
9 SASI_Hs01_00088986 predicted 2989
10 SASI_Hs01_00088987 predicted 2987
11 SASI_Hs01_00088985 predicted 3856
12 SASI_Hs01_00088988 predicted 4077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225826 predicted 1587
2 SASI_Rn02_00225827 predicted 2402
3 SASI_Rn02_00225828 predicted 2363
4 SASI_Rn02_00225829 predicted 2761
5 SASI_Rn02_00225830 predicted 1718
6 SASI_Rn02_00225831 predicted 635
7 SASI_Rn02_00225832 predicted 542
8 SASI_Rn02_00225833 predicted 1901
9 SASI_Rn02_00225834 predicted 2405
10 SASI_Rn02_00225835 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156774 predicted 521
2 SASI_Mm01_00156776 predicted 663
3 SASI_Mm01_00156777 predicted 644
4 SASI_Mm02_00337168 predicted 317
5 SASI_Mm01_00156778 predicted 586
6 SASI_Mm01_00156779 predicted 632
7 SASI_Mm01_00156780 predicted 2047
8 SASI_Mm01_00156781 predicted 2037
9 SASI_Mm01_00156782 predicted 520
10 SASI_Mm01_00156783 predicted 2591
11 SASI_Mm01_00156775 predicted 1840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022574
VALIDATED
GIGYF1 MISSION shRNA Bacterial Glycerol Stock
GRB10 interacting GYF protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022574.2-2433s1c1
Sequence:CCGGCCAAAGAATTTGCCAAACAATCTCGAGATTGTTTGGCAAATTCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022574.2-898s1c1
Sequence:CCGGCTTCTTGCCTCTCAAGCTGTTCTCGAGAACAGCTTGAGAGGCAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022574.2-2652s1c1
Sequence:CCGGGATCTTCTGGTGAGATCGAGACTCGAGTCTCGATCTCACCAGAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022574.2-2181s1c1
Sequence:CCGGGTGACTCATACAGCCACCTATCTCGAGATAGGTGGCTGTATGAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-1501s21c1
Sequence:CCGGGCGGTTTGAGAAGTCAGCAAGCTCGAGCTTGCTGACTTCTCAAACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-2993s21c1
Sequence:CCGGCTTTGGGACATACCAATTAACCTCGAGGTTAATTGGTATGTCCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022574.4-4413s21c1
Sequence:CCGGAGGATAGTGGGTGTGACAATGCTCGAGCATTGTCACACCCACTATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-3016s21c1
Sequence:CCGGTTCGACTCAGGGTCCAATTCTCTCGAGAGAATTGGACCCTGAGTCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-3043s21c1
Sequence:CCGGACTCCAGCTGCAACATAAATTCTCGAGAATTTATGTTGCAGCTGGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-1113s21c1
Sequence:CCGGAGCTGGCTGACTACCGTTATGCTCGAGCATAACGGTAGTCAGCCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022574
VALIDATED
GIGYF1 MISSION shRNA shRNA Plasmid DNA
GRB10 interacting GYF protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022574.2-2433s1c1
Sequence:CCGGCCAAAGAATTTGCCAAACAATCTCGAGATTGTTTGGCAAATTCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022574.2-898s1c1
Sequence:CCGGCTTCTTGCCTCTCAAGCTGTTCTCGAGAACAGCTTGAGAGGCAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022574.2-2652s1c1
Sequence:CCGGGATCTTCTGGTGAGATCGAGACTCGAGTCTCGATCTCACCAGAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022574.2-2181s1c1
Sequence:CCGGGTGACTCATACAGCCACCTATCTCGAGATAGGTGGCTGTATGAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-1501s21c1
Sequence:CCGGGCGGTTTGAGAAGTCAGCAAGCTCGAGCTTGCTGACTTCTCAAACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-2993s21c1
Sequence:CCGGCTTTGGGACATACCAATTAACCTCGAGGTTAATTGGTATGTCCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022574.4-4413s21c1
Sequence:CCGGAGGATAGTGGGTGTGACAATGCTCGAGCATTGTCACACCCACTATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-3016s21c1
Sequence:CCGGTTCGACTCAGGGTCCAATTCTCTCGAGAGAATTGGACCCTGAGTCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-3043s21c1
Sequence:CCGGACTCCAGCTGCAACATAAATTCTCGAGAATTTATGTTGCAGCTGGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-1113s21c1
Sequence:CCGGAGCTGGCTGACTACCGTTATGCTCGAGCATAACGGTAGTCAGCCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022574
VALIDATED
GIGYF1 MISSION shRNA Lentiviral Transduction Particles
GRB10 interacting GYF protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022574.2-2433s1c1
Sequence:CCGGCCAAAGAATTTGCCAAACAATCTCGAGATTGTTTGGCAAATTCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172430    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022574.2-898s1c1
Sequence:CCGGCTTCTTGCCTCTCAAGCTGTTCTCGAGAACAGCTTGAGAGGCAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_022574.2-2652s1c1
Sequence:CCGGGATCTTCTGGTGAGATCGAGACTCGAGTCTCGATCTCACCAGAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022574.2-2181s1c1
Sequence:CCGGGTGACTCATACAGCCACCTATCTCGAGATAGGTGGCTGTATGAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-1501s21c1
Sequence:CCGGGCGGTTTGAGAAGTCAGCAAGCTCGAGCTTGCTGACTTCTCAAACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-2993s21c1
Sequence:CCGGCTTTGGGACATACCAATTAACCTCGAGGTTAATTGGTATGTCCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022574.4-4413s21c1
Sequence:CCGGAGGATAGTGGGTGTGACAATGCTCGAGCATTGTCACACCCACTATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-3016s21c1
Sequence:CCGGTTCGACTCAGGGTCCAATTCTCTCGAGAGAATTGGACCCTGAGTCGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-3043s21c1
Sequence:CCGGACTCCAGCTGCAACATAAATTCTCGAGAATTTATGTTGCAGCTGGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022574.4-1113s21c1
Sequence:CCGGAGCTGGCTGACTACCGTTATGCTCGAGCATAACGGTAGTCAGCCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031408
VALIDATED
GIGYF1 MISSION shRNA Bacterial Glycerol Stock
GRB10 interacting GYF protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031408.1-1877s1c1
Sequence:CCGGCCAGTCTTTGGGACATACCAACTCGAGTTGGTATGTCCCAAAGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031408.1-2110s1c1
Sequence:CCGGGAATTGTTGCTGAAGCTGCTACTCGAGTAGCAGCTTCAGCAACAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031408.1-2714s1c1
Sequence:CCGGCTTACGATGTCCATGATTATACTCGAGTATAATCATGGACATCGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031408.1-747s1c1
Sequence:CCGGCGATGGCTTTGAAGATGACAACTCGAGTTGTCATCTTCAAAGCCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031408.1-85s1c1
Sequence:CCGGGAACTACAGGACAAGGAGTTTCTCGAGAAACTCCTTGTCCTGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031408.2-2066s21c1
Sequence:CCGGCTTCGACTCAGGGTCCAATTCCTCGAGGAATTGGACCCTGAGTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031408.2-2876s21c1
Sequence:CCGGCTTACGATGTCCATGATTATACTCGAGTATAATCATGGACATCGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031408.2-909s21c1
Sequence:CCGGCGATGGCTTTGAAGATGACAACTCGAGTTGTCATCTTCAAAGCCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031408.2-247s21c1
Sequence:CCGGGAACTACAGGACAAGGAGTTTCTCGAGAAACTCCTTGTCCTGTAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216088    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031408.2-4648s1c1
Sequence:CCGGCATGAATGTATTTCTAGTTTCCTCGAGGAAACTAGAAATACATTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031408
VALIDATED
GIGYF1 MISSION shRNA shRNA Plasmid DNA
GRB10 interacting GYF protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031408.1-1877s1c1
Sequence:CCGGCCAGTCTTTGGGACATACCAACTCGAGTTGGTATGTCCCAAAGACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031408.1-2110s1c1
Sequence:CCGGGAATTGTTGCTGAAGCTGCTACTCGAGTAGCAGCTTCAGCAACAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031408.1-2714s1c1
Sequence:CCGGCTTACGATGTCCATGATTATACTCGAGTATAATCATGGACATCGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031408.1-747s1c1
Sequence:CCGGCGATGGCTTTGAAGATGACAACTCGAGTTGTCATCTTCAAAGCCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031408.1-85s1c1
Sequence:CCGGGAACTACAGGACAAGGAGTTTCTCGAGAAACTCCTTGTCCTGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031408.2-2066s21c1
Sequence:CCGGCTTCGACTCAGGGTCCAATTCCTCGAGGAATTGGACCCTGAGTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031408.2-2876s21c1
Sequence:CCGGCTTACGATGTCCATGATTATACTCGAGTATAATCATGGACATCGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031408.2-909s21c1
Sequence:CCGGCGATGGCTTTGAAGATGACAACTCGAGTTGTCATCTTCAAAGCCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031408.2-247s21c1
Sequence:CCGGGAACTACAGGACAAGGAGTTTCTCGAGAAACTCCTTGTCCTGTAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216088    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031408.2-4648s1c1
Sequence:CCGGCATGAATGTATTTCTAGTTTCCTCGAGGAAACTAGAAATACATTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031408
VALIDATED
GIGYF1 MISSION shRNA Lentiviral Transduction Particles
GRB10 interacting GYF protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031408.1-1877s1c1
Sequence:CCGGCCAGTCTTTGGGACATACCAACTCGAGTTGGTATGTCCCAAAGACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031408.1-2110s1c1
Sequence:CCGGGAATTGTTGCTGAAGCTGCTACTCGAGTAGCAGCTTCAGCAACAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031408.1-2714s1c1
Sequence:CCGGCTTACGATGTCCATGATTATACTCGAGTATAATCATGGACATCGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031408.1-747s1c1
Sequence:CCGGCGATGGCTTTGAAGATGACAACTCGAGTTGTCATCTTCAAAGCCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031408.1-85s1c1
Sequence:CCGGGAACTACAGGACAAGGAGTTTCTCGAGAAACTCCTTGTCCTGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031408.2-2066s21c1
Sequence:CCGGCTTCGACTCAGGGTCCAATTCCTCGAGGAATTGGACCCTGAGTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031408.2-2876s21c1
Sequence:CCGGCTTACGATGTCCATGATTATACTCGAGTATAATCATGGACATCGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031408.2-909s21c1
Sequence:CCGGCGATGGCTTTGAAGATGACAACTCGAGTTGTCATCTTCAAAGCCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031408.2-247s21c1
Sequence:CCGGGAACTACAGGACAAGGAGTTTCTCGAGAAACTCCTTGTCCTGTAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216088    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031408.2-4648s1c1
Sequence:CCGGCATGAATGTATTTCTAGTTTCCTCGAGGAAACTAGAAATACATTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)