EMAIL THIS PAGE TO A FRIEND

GJB1

gap junction protein, beta 1, 32kDa

98 Gene Product Result for
Synonyms: CMTX CMTX1 CX32
UniProtKB ID: P08034, B2R8R2, D3DVV2, Q5U0S4
Gene ID:
Human(2705) Summary: This gene encodes a member of the gap junction protein family. The gap junction proteins are membrane-spanning proteins that assemble to form gap junction channels that facilitate the transfer of ions and small molecules between cells. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene cause X-linked Charcot-Marie-Tooth disease, an inherited peripheral neuropathy. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(14618) gap junction protein, beta 1
Rat(29584) gap junction protein, beta 1
chicken(378797) gap junction protein, beta 1, 32kDa
dog(480953) gap junction protein, beta 1, 32kDa
domestic cat(101091678) gap junction protein, beta 1, 32kDa
Horse(100034021) gap junction protein, beta 1, 32kDa
cow(281194) gap junction protein, beta 1, 32kDa
sheep(101104806) gap junction protein, beta 1, 32kDa
Domestic Rabbit(100008934) gap junction protein, beta 1, 32kDa
domestic guinea pig(100379282) gap junction protein, beta 1
naked mole-rat(101716637) gap junction protein, beta 1, 32kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C3595 Anti-Connexin-32 (106-124) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunohistochemistry, western blot pricing
C3470 Anti-Connexin-32 (265-279) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunohistochemistry, microarray, western blot pricing
SAB2108314 Anti-GJB1 antibody produced in rabbit affinity isolated antibody canine, bovine, mouse, rat, horse, guinea pig, rabbit, human
immunohistochemistry, western blot pricing
HPA010663 Anti-GJB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing
AV36600 Anti-GJB1 antibody produced in rabbit IgG fraction of antiserum human, rat, horse, guinea pig, canine, mouse, rabbit, rabbit, bovine
immunohistochemistry, western blot pricing
SAB2104320 Anti-GJB1 antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, rabbit, horse, mouse, rabbit, bovine, rat, human
western blot pricing
C6344 Monoclonal Anti-Connexin-32 antibody produced in mouse clone CXN-32, ascites fluid, buffered aqueous solution rat, human, mouse
ELISA, immunohistochemistry, microarray, western blot pricing
SAB1403864 Monoclonal Anti-GJB1 antibody produced in mouse clone 2B9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1402208 Monoclonal Anti-GJB1 antibody produced in mouse clone 1F5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008124 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008124 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008124 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000166 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000166 Rosetta Predictions human pricing
NM_001097642 Rosetta Predictions human pricing
NM_017251 Rosetta Predictions rat pricing
NM_008124 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180911 predicted 557
2 SASI_Hs01_00180912 predicted 1180
3 SASI_Hs01_00180913 predicted 529
4 SASI_Hs01_00180914 predicted 1185
5 SASI_Hs01_00180916 predicted 1338
6 SASI_Hs02_00301996 predicted 551
7 SASI_Hs02_00301997 predicted 1405
8 SASI_Hs01_00180917 predicted 324
9 SASI_Hs01_00180918 predicted 404
10 SASI_Hs01_00180919 predicted 632
11 SASI_Hs01_00180915 predicted 301
12 SASI_Hs01_00180920 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318561 predicted 503
2 SASI_Hs02_00318562 predicted 1125
3 SASI_Hs02_00318563 predicted 485
4 SASI_Hs02_00318564 predicted 1131
5 SASI_Hs02_00318565 predicted 1284
6 SASI_Hs02_00318566 predicted 502
7 SASI_Hs02_00318567 predicted 1354
8 SASI_Hs02_00318568 predicted 271
9 SASI_Hs02_00318569 predicted 353
10 SASI_Hs02_00318570 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017251 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070103 predicted 252
2 SASI_Rn01_00070104 predicted 474
3 SASI_Rn01_00070105 predicted 337
4 SASI_Rn02_00261639 predicted 499
5 SASI_Rn01_00070106 predicted 1216
6 SASI_Rn01_00070107 predicted 1153
7 SASI_Rn01_00070108 predicted 218
8 SASI_Rn02_00261640 predicted 562
9 SASI_Rn01_00070109 predicted 946
10 SASI_Rn01_00070110 predicted 217
11 SASI_Rn01_00070111 predicted 1153
12 SASI_Rn01_00070112 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051609 predicted 514
2 SASI_Mm01_00051610 predicted 1117
3 SASI_Mm01_00051611 predicted 1088
4 SASI_Mm01_00051612 predicted 1172
5 SASI_Mm01_00051613 predicted 423
6 SASI_Mm01_00051614 predicted 1024
7 SASI_Mm01_00051615 predicted 1094
8 SASI_Mm01_00051616 predicted 864
9 SASI_Mm01_00051617 predicted 969
10 SASI_Mm01_00051618 predicted 321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008124
GJB1 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, beta 1, 32kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008124.2-382s21c1
Sequence:CCGGCTTCACCTGGAAGAGGTAAAGCTCGAGCTTTACCTCTTCCAGGTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008124.2-975s21c1
Sequence:CCGGCTTCTGCCTGATAGGGATTATCTCGAGATAATCCCTATCAGGCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008124.2-1090s21c1
Sequence:CCGGCAACAGGGCTCAAGGTTATTACTCGAGTAATAACCTTGAGCCCTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008124.2-90s21c1
Sequence:CCGGTACAGCCATTGGCCGAGTATGCTCGAGCATACTCGGCCAATGGCTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008124.2-1165s1c1
Sequence:CCGGCGAGGGATGAGATGTTCTGAACTCGAGTTCAGAACATCTCATCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008124.2-756s1c1
Sequence:CCGGCTCACCTGAATACAAGCAGAACTCGAGTTCTGCTTGTATTCAGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008124.2-481s1c1
Sequence:CCGGGTCTTCATGTATGTCTTCTATCTCGAGATAGAAGACATACATGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008124.2-325s1c1
Sequence:CCGGGCTCACCAACAGCACATAGAACTCGAGTTCTATGTGCTGTTGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008124.2-633s1c1
Sequence:CCGGCGGCATCTGCATTATCCTCAACTCGAGTTGAGGATAATGCAGATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008124
GJB1 MISSION shRNA shRNA Plasmid DNA
gap junction protein, beta 1, 32kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008124.2-382s21c1
Sequence:CCGGCTTCACCTGGAAGAGGTAAAGCTCGAGCTTTACCTCTTCCAGGTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008124.2-975s21c1
Sequence:CCGGCTTCTGCCTGATAGGGATTATCTCGAGATAATCCCTATCAGGCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008124.2-1090s21c1
Sequence:CCGGCAACAGGGCTCAAGGTTATTACTCGAGTAATAACCTTGAGCCCTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008124.2-90s21c1
Sequence:CCGGTACAGCCATTGGCCGAGTATGCTCGAGCATACTCGGCCAATGGCTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008124.2-1165s1c1
Sequence:CCGGCGAGGGATGAGATGTTCTGAACTCGAGTTCAGAACATCTCATCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008124.2-756s1c1
Sequence:CCGGCTCACCTGAATACAAGCAGAACTCGAGTTCTGCTTGTATTCAGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008124.2-481s1c1
Sequence:CCGGGTCTTCATGTATGTCTTCTATCTCGAGATAGAAGACATACATGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008124.2-325s1c1
Sequence:CCGGGCTCACCAACAGCACATAGAACTCGAGTTCTATGTGCTGTTGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008124.2-633s1c1
Sequence:CCGGCGGCATCTGCATTATCCTCAACTCGAGTTGAGGATAATGCAGATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008124
GJB1 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, beta 1, 32kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008124.2-382s21c1
Sequence:CCGGCTTCACCTGGAAGAGGTAAAGCTCGAGCTTTACCTCTTCCAGGTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008124.2-975s21c1
Sequence:CCGGCTTCTGCCTGATAGGGATTATCTCGAGATAATCCCTATCAGGCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008124.2-1090s21c1
Sequence:CCGGCAACAGGGCTCAAGGTTATTACTCGAGTAATAACCTTGAGCCCTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008124.2-90s21c1
Sequence:CCGGTACAGCCATTGGCCGAGTATGCTCGAGCATACTCGGCCAATGGCTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008124.2-1165s1c1
Sequence:CCGGCGAGGGATGAGATGTTCTGAACTCGAGTTCAGAACATCTCATCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008124.2-756s1c1
Sequence:CCGGCTCACCTGAATACAAGCAGAACTCGAGTTCTGCTTGTATTCAGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008124.2-481s1c1
Sequence:CCGGGTCTTCATGTATGTCTTCTATCTCGAGATAGAAGACATACATGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008124.2-325s1c1
Sequence:CCGGGCTCACCAACAGCACATAGAACTCGAGTTCTATGTGCTGTTGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008124.2-633s1c1
Sequence:CCGGCGGCATCTGCATTATCCTCAACTCGAGTTGAGGATAATGCAGATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000166
GJB1 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, beta 1, 32kDa
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000166.5-211s21c1
Sequence:CCGGGAGTATGGCTCTCGGTCATCTCTCGAGAGATGACCGAGAGCCATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-565s1c1
Sequence:CCGGGCCGTCTTCATGTATGTCTTTCTCGAGAAAGACATACATGAAGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-417s1c1
Sequence:CCGGCCAGCAACACATAGAGAAGAACTCGAGTTCTTCTCTATGTGTTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-312s1c1
Sequence:CCGGCGTTTGCTATGACCAATTCTTCTCGAGAAGAATTGGTCATAGCAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-837s1c1
Sequence:CCGGCCGCCTCTCACCTGAATACAACTCGAGTTGTATTCAGGTGAGAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-528s1c1
Sequence:CCGGCTATGTCATCAGCGTGGTGTTCTCGAGAACACCACGCTGATGACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000166
GJB1 MISSION shRNA shRNA Plasmid DNA
gap junction protein, beta 1, 32kDa
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000166.5-211s21c1
Sequence:CCGGGAGTATGGCTCTCGGTCATCTCTCGAGAGATGACCGAGAGCCATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-565s1c1
Sequence:CCGGGCCGTCTTCATGTATGTCTTTCTCGAGAAAGACATACATGAAGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-417s1c1
Sequence:CCGGCCAGCAACACATAGAGAAGAACTCGAGTTCTTCTCTATGTGTTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-312s1c1
Sequence:CCGGCGTTTGCTATGACCAATTCTTCTCGAGAAGAATTGGTCATAGCAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-837s1c1
Sequence:CCGGCCGCCTCTCACCTGAATACAACTCGAGTTGTATTCAGGTGAGAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-528s1c1
Sequence:CCGGCTATGTCATCAGCGTGGTGTTCTCGAGAACACCACGCTGATGACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000166
GJB1 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, beta 1, 32kDa
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000166.5-211s21c1
Sequence:CCGGGAGTATGGCTCTCGGTCATCTCTCGAGAGATGACCGAGAGCCATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-565s1c1
Sequence:CCGGGCCGTCTTCATGTATGTCTTTCTCGAGAAAGACATACATGAAGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-417s1c1
Sequence:CCGGCCAGCAACACATAGAGAAGAACTCGAGTTCTTCTCTATGTGTTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-312s1c1
Sequence:CCGGCGTTTGCTATGACCAATTCTTCTCGAGAAGAATTGGTCATAGCAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-837s1c1
Sequence:CCGGCCGCCTCTCACCTGAATACAACTCGAGTTGTATTCAGGTGAGAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000166.2-528s1c1
Sequence:CCGGCTATGTCATCAGCGTGGTGTTCTCGAGAACACCACGCTGATGACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)