EMAIL THIS PAGE TO A FRIEND

GJB2

gap junction protein, beta 2, 26kDa

60 Gene Product Result for
Synonyms: CX26 DFNA3 DFNA3A DFNB1 DFNB1A HID KID NSRD1 PPK
Gene ID:
Human(2706) Summary: This gene encodes a member of the gap junction protein family. The gap junctions were first characterized by electron microscopy as regionally specialized structures on plasma membranes of contacting adherent cells. These structures were shown to consist of cell-to-cell channels that facilitate the transfer of ions and small molecules between cells. The gap junction proteins, also known as connexins, purified from fractions of enriched gap junctions from different tissues differ. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene are responsible for as much as 50% of pre-lingual, recessive deafness. [provided by RefSeq, Oct 2008]
Mouse(14619) gap junction protein, beta 2
Rat(394266) gap junction protein, beta 2
naked mole-rat(101710607) gap junction protein, beta 2, 26kDa
domestic guinea pig(100379528) gap junction protein, beta 2
sheep(443345) gap junction protein, beta 2, 26kDa
chicken(428083) gap junction protein, beta 2, 26kDa
cow(407154) gap junction protein, beta 2, 26kDa
domestic cat(101082540) gap junction protein, beta 2, 26kDa
dog(403570) gap junction protein, beta 2, 26kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004004 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008125 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008125 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008125 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004004 Rosetta Predictions human pricing
NM_001004099 Rosetta Predictions rat pricing
NM_008125 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056833 predicted 1037
2 SASI_Hs01_00056834 predicted 994
3 SASI_Hs01_00056835 predicted 784
4 SASI_Hs01_00056836 predicted 835
5 SASI_Hs01_00056837 predicted 987
6 SASI_Hs01_00056840 predicted 1178
7 SASI_Hs02_00336736 predicted 972
8 SASI_Hs01_00056842 predicted 827
9 SASI_Hs02_00336737 predicted 1169
10 SASI_Hs02_00336738 predicted 844
11 SASI_Hs01_00056838 predicted 710
12 SASI_Hs01_00056839 predicted 764
13 SASI_Hs01_00056841 predicted 900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070420 predicted 1148
2 SASI_Rn01_00070421 predicted 1042
3 SASI_Rn01_00070422 predicted 1217
4 SASI_Rn02_00198153 predicted 856
5 SASI_Rn01_00070423 predicted 585
6 SASI_Rn01_00070424 predicted 607
7 SASI_Rn01_00070425 predicted 874
8 SASI_Rn01_00070426 predicted 594
9 SASI_Rn01_00070427 predicted 1052
10 SASI_Rn01_00070428 predicted 1056
11 SASI_Rn01_00070429 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169392 predicted 868
2 SASI_Mm01_00169393 predicted 793
3 SASI_Mm01_00169394 predicted 962
4 SASI_Mm01_00169395 predicted 594
5 SASI_Mm01_00169396 predicted 850
6 SASI_Mm01_00169397 predicted 563
7 SASI_Mm01_00169398 predicted 824
8 SASI_Mm01_00169399 predicted 908
9 SASI_Mm01_00169400 predicted 548
10 SASI_Mm01_00169401 predicted 596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004004
GJB2 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, beta 2, 26kDa
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-600s1c1
Sequence:CCGGCTATGTCATGTACGACGGCTTCTCGAGAAGCCGTCGTACATGACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-583s1c1
Sequence:CCGGGCCTTCATGTACGTCTTCTATCTCGAGATAGAAGACGTACATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-474s1c1
Sequence:CCGGGAGTGAATTTAAGGACATCGACTCGAGTCGATGTCCTTAAATTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-706s1c1
Sequence:CCGGGTCTTCACAGTGTTCATGATTCTCGAGAATCATGAACACTGTGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-321s1c1
Sequence:CCGGGAACGTGTGCTACGATCACTACTCGAGTAGTGATCGTAGCACACGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004004.5-901s21c1
Sequence:CCGGTTGCCCAGTTGTTAGATTAAGCTCGAGCTTAATCTAACAACTGGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004004.5-1171s21c1
Sequence:CCGGTTATTGGTGTAAGGTACTTTCCTCGAGGAAAGTACCTTACACCAATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004004.5-1105s21c1
Sequence:CCGGATTCTATGCCTGTCTTAATTTCTCGAGAAATTAAGACAGGCATAGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004004
GJB2 MISSION shRNA shRNA Plasmid DNA
gap junction protein, beta 2, 26kDa
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-600s1c1
Sequence:CCGGCTATGTCATGTACGACGGCTTCTCGAGAAGCCGTCGTACATGACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-583s1c1
Sequence:CCGGGCCTTCATGTACGTCTTCTATCTCGAGATAGAAGACGTACATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-474s1c1
Sequence:CCGGGAGTGAATTTAAGGACATCGACTCGAGTCGATGTCCTTAAATTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-706s1c1
Sequence:CCGGGTCTTCACAGTGTTCATGATTCTCGAGAATCATGAACACTGTGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-321s1c1
Sequence:CCGGGAACGTGTGCTACGATCACTACTCGAGTAGTGATCGTAGCACACGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004004.5-901s21c1
Sequence:CCGGTTGCCCAGTTGTTAGATTAAGCTCGAGCTTAATCTAACAACTGGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004004.5-1171s21c1
Sequence:CCGGTTATTGGTGTAAGGTACTTTCCTCGAGGAAAGTACCTTACACCAATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004004.5-1105s21c1
Sequence:CCGGATTCTATGCCTGTCTTAATTTCTCGAGAAATTAAGACAGGCATAGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004004
GJB2 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, beta 2, 26kDa
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-600s1c1
Sequence:CCGGCTATGTCATGTACGACGGCTTCTCGAGAAGCCGTCGTACATGACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-583s1c1
Sequence:CCGGGCCTTCATGTACGTCTTCTATCTCGAGATAGAAGACGTACATGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-474s1c1
Sequence:CCGGGAGTGAATTTAAGGACATCGACTCGAGTCGATGTCCTTAAATTCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-706s1c1
Sequence:CCGGGTCTTCACAGTGTTCATGATTCTCGAGAATCATGAACACTGTGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004004.3-321s1c1
Sequence:CCGGGAACGTGTGCTACGATCACTACTCGAGTAGTGATCGTAGCACACGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004004.5-901s21c1
Sequence:CCGGTTGCCCAGTTGTTAGATTAAGCTCGAGCTTAATCTAACAACTGGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004004.5-1171s21c1
Sequence:CCGGTTATTGGTGTAAGGTACTTTCCTCGAGGAAAGTACCTTACACCAATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004004.5-1105s21c1
Sequence:CCGGATTCTATGCCTGTCTTAATTTCTCGAGAAATTAAGACAGGCATAGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008125
VALIDATED
GJB2 MISSION shRNA Bacterial Glycerol Stock
gap junction protein, beta 2, 26kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008125.2-270s1c1
Sequence:CCGGCAACAAACACTCCACCAGCATCTCGAGATGCTGGTGGAGTGTTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008125.2-673s1c1
Sequence:CCGGGCCGTCTTCATGTACGTCTTTCTCGAGAAAGACGTACATGAAGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008125.2-725s1c1
Sequence:CCGGGTCTGGTGAAATGCAACGCTTCTCGAGAAGCGTTGCATTTCACCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008125.2-557s1c1
Sequence:CCGGGAGAGATAAAGAACGAGTTTACTCGAGTAAACTCGTTCTTTATCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008125.2-863s1c1
Sequence:CCGGGCTATTTGTTCGTTAGGTATTCTCGAGAATACCTAACGAACAAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008125.3-819s21c1
Sequence:CCGGAGACTGTCTTCACCGTGTTTACTCGAGTAAACACGGTGAAGACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008125.3-1383s21c1
Sequence:CCGGTAGTTTACGTGTGCAACAATGCTCGAGCATTGTTGCACACGTAAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008125.3-1210s21c1
Sequence:CCGGCCAAGCTTGGAGGATACATTCCTCGAGGAATGTATCCTCCAAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008125.3-583s21c1
Sequence:CCGGAGAGATAAAGAACGAGTTTAACTCGAGTTAAACTCGTTCTTTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008125.3-853s21c1
Sequence:CCGGTGGAATTTGCATTCTGCTAAACTCGAGTTTAGCAGAATGCAAATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008125
VALIDATED
GJB2 MISSION shRNA shRNA Plasmid DNA
gap junction protein, beta 2, 26kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008125.2-270s1c1
Sequence:CCGGCAACAAACACTCCACCAGCATCTCGAGATGCTGGTGGAGTGTTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008125.2-673s1c1
Sequence:CCGGGCCGTCTTCATGTACGTCTTTCTCGAGAAAGACGTACATGAAGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008125.2-725s1c1
Sequence:CCGGGTCTGGTGAAATGCAACGCTTCTCGAGAAGCGTTGCATTTCACCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008125.2-557s1c1
Sequence:CCGGGAGAGATAAAGAACGAGTTTACTCGAGTAAACTCGTTCTTTATCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008125.2-863s1c1
Sequence:CCGGGCTATTTGTTCGTTAGGTATTCTCGAGAATACCTAACGAACAAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008125.3-819s21c1
Sequence:CCGGAGACTGTCTTCACCGTGTTTACTCGAGTAAACACGGTGAAGACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008125.3-1383s21c1
Sequence:CCGGTAGTTTACGTGTGCAACAATGCTCGAGCATTGTTGCACACGTAAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008125.3-1210s21c1
Sequence:CCGGCCAAGCTTGGAGGATACATTCCTCGAGGAATGTATCCTCCAAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008125.3-583s21c1
Sequence:CCGGAGAGATAAAGAACGAGTTTAACTCGAGTTAAACTCGTTCTTTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008125.3-853s21c1
Sequence:CCGGTGGAATTTGCATTCTGCTAAACTCGAGTTTAGCAGAATGCAAATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008125
VALIDATED
GJB2 MISSION shRNA Lentiviral Transduction Particles
gap junction protein, beta 2, 26kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008125.2-270s1c1
Sequence:CCGGCAACAAACACTCCACCAGCATCTCGAGATGCTGGTGGAGTGTTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008125.2-673s1c1
Sequence:CCGGGCCGTCTTCATGTACGTCTTTCTCGAGAAAGACGTACATGAAGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008125.2-725s1c1
Sequence:CCGGGTCTGGTGAAATGCAACGCTTCTCGAGAAGCGTTGCATTTCACCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008125.2-557s1c1
Sequence:CCGGGAGAGATAAAGAACGAGTTTACTCGAGTAAACTCGTTCTTTATCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008125.2-863s1c1
Sequence:CCGGGCTATTTGTTCGTTAGGTATTCTCGAGAATACCTAACGAACAAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008125.3-819s21c1
Sequence:CCGGAGACTGTCTTCACCGTGTTTACTCGAGTAAACACGGTGAAGACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008125.3-1383s21c1
Sequence:CCGGTAGTTTACGTGTGCAACAATGCTCGAGCATTGTTGCACACGTAAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008125.3-1210s21c1
Sequence:CCGGCCAAGCTTGGAGGATACATTCCTCGAGGAATGTATCCTCCAAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008125.3-583s21c1
Sequence:CCGGAGAGATAAAGAACGAGTTTAACTCGAGTTAAACTCGTTCTTTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008125.3-853s21c1
Sequence:CCGGTGGAATTTGCATTCTGCTAAACTCGAGTTTAGCAGAATGCAAATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)