EMAIL THIS PAGE TO A FRIEND

GLB1

galactosidase, beta 1

73 Gene Product Result for
Synonyms: EBP ELNR1 MPS4B
UniProtKB ID: P16278, B2R7H8, B7Z6B0, P16279
Gene ID:
Human(2720) Summary: This gene encodes beta-galactosidase-1, a lysosomal enzyme that hydrolyzes the terminal beta-galactose from ganglioside substrates and other glycoconjugates. Defects in this gene are the cause of GM1-gangliosidosis and Morquio B syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(12091) galactosidase, beta 1
Rat(316033) galactosidase, beta 1
Zebrafish(548343) galactosidase, beta 1
cow(507188) galactosidase, beta 1
domestic cat(493927) galactosidase, beta 1
dog(403873) galactosidase, beta 1
chicken(420720) galactosidase, beta 1
Thale Cress(828213) GLNB1-like protein
sheep(101112930) galactosidase, beta 1
domestic guinea pig(100721349) galactosidase, beta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D1542 1,4-Dideoxy-1,4-imino-D-arabinitol hydrochloride enzyme inhibitor human, mouse, rat pricing
M1777 N-Methyl-1-deoxynojirimycin ≥98% mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000404 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009752 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009752 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009752 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000404 Rosetta Predictions human pricing
NM_001079811 Rosetta Predictions human pricing
NM_001108192 Rosetta Predictions rat pricing
NM_009752 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214673 predicted 1560
2 SASI_Hs01_00214674 predicted 2165
3 SASI_Hs02_00302486 predicted 2223
4 SASI_Hs01_00214675 predicted 2036
5 SASI_Hs01_00214676 predicted 1616
6 SASI_Hs02_00302487 predicted 1830
7 SASI_Hs01_00214677 predicted 635
8 SASI_Hs01_00214678 predicted 1865
9 SASI_Hs01_00214679 predicted 570
10 SASI_Hs01_00214680 predicted 770
11 SASI_Hs01_00214681 predicted 702
12 SASI_Hs01_00214682 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313780 predicted 1473
2 SASI_Hs02_00313781 predicted 2086
3 SASI_Hs02_00313782 predicted 2129
4 SASI_Hs02_00313783 predicted 1953
5 SASI_Hs02_00313784 predicted 1532
6 SASI_Hs02_00313785 predicted 1738
7 SASI_Hs02_00313786 predicted 552
8 SASI_Hs02_00313787 predicted 1772
9 SASI_Hs02_00313788 predicted 482
10 SASI_Hs02_00313789 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236234 predicted 715
2 SASI_Rn02_00236235 predicted 1124
3 SASI_Rn02_00236236 predicted 1983
4 SASI_Rn02_00236237 predicted 642
5 SASI_Rn02_00236238 predicted 1856
6 SASI_Rn02_00236239 predicted 917
7 SASI_Rn02_00236240 predicted 217
8 SASI_Rn02_00236241 predicted 527
9 SASI_Rn02_00236242 predicted 1455
10 SASI_Rn02_00236243 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009752 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072464 predicted 523
2 SASI_Mm01_00072465 predicted 1541
3 SASI_Mm01_00072466 predicted 1787
4 SASI_Mm01_00072467 predicted 470
5 SASI_Mm01_00072469 predicted 1811
6 SASI_Mm01_00072470 predicted 1449
7 SASI_Mm01_00072471 predicted 1168
8 SASI_Mm01_00072472 predicted 1428
9 SASI_Mm01_00072473 predicted 1380
10 SASI_Mm02_00316938 predicted 500
11 SASI_Mm01_00072468 predicted 2111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000404
VALIDATED
GLB1 MISSION shRNA Bacterial Glycerol Stock
galactosidase, beta 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-2126s1c1
Sequence:CCGGCCCTGAACATACCTCACAGATCTCGAGATCTGTGAGGTATGTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-1505s1c1
Sequence:CCGGGTGTGAACTATGGTGCATATACTCGAGTATATGCACCATAGTTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-205s1c1
Sequence:CCGGCGCTACATCTCAGGAAGCATTCTCGAGAATGCTTCCTGAGATGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-629s1c1
Sequence:CCGGGCAGCTACTTTGCCTGTGATTCTCGAGAATCACAGGCAAAGTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-1504s1c1
Sequence:CCGGCGTGTGAACTATGGTGCATATCTCGAGATATGCACCATAGTTCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000404.2-262s21c1
Sequence:CCGGCGCTACATCTCAGGAAGCATTCTCGAGAATGCTTCCTGAGATGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000404.2-686s21c1
Sequence:CCGGGCAGCTACTTTGCCTGTGATTCTCGAGAATCACAGGCAAAGTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000404.2-1561s21c1
Sequence:CCGGCGTGTGAACTATGGTGCATATCTCGAGATATGCACCATAGTTCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000404.2-2183s21c1
Sequence:CCGGCCCTGAACATACCTCACAGATCTCGAGATCTGTGAGGTATGTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000404
VALIDATED
GLB1 MISSION shRNA shRNA Plasmid DNA
galactosidase, beta 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-2126s1c1
Sequence:CCGGCCCTGAACATACCTCACAGATCTCGAGATCTGTGAGGTATGTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-1505s1c1
Sequence:CCGGGTGTGAACTATGGTGCATATACTCGAGTATATGCACCATAGTTCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-205s1c1
Sequence:CCGGCGCTACATCTCAGGAAGCATTCTCGAGAATGCTTCCTGAGATGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-629s1c1
Sequence:CCGGGCAGCTACTTTGCCTGTGATTCTCGAGAATCACAGGCAAAGTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-1504s1c1
Sequence:CCGGCGTGTGAACTATGGTGCATATCTCGAGATATGCACCATAGTTCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000404.2-262s21c1
Sequence:CCGGCGCTACATCTCAGGAAGCATTCTCGAGAATGCTTCCTGAGATGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000404.2-686s21c1
Sequence:CCGGGCAGCTACTTTGCCTGTGATTCTCGAGAATCACAGGCAAAGTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000404.2-1561s21c1
Sequence:CCGGCGTGTGAACTATGGTGCATATCTCGAGATATGCACCATAGTTCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000404.2-2183s21c1
Sequence:CCGGCCCTGAACATACCTCACAGATCTCGAGATCTGTGAGGTATGTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000404
VALIDATED
GLB1 MISSION shRNA Lentiviral Transduction Particles
galactosidase, beta 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-2126s1c1
Sequence:CCGGCCCTGAACATACCTCACAGATCTCGAGATCTGTGAGGTATGTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-1505s1c1
Sequence:CCGGGTGTGAACTATGGTGCATATACTCGAGTATATGCACCATAGTTCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-205s1c1
Sequence:CCGGCGCTACATCTCAGGAAGCATTCTCGAGAATGCTTCCTGAGATGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-629s1c1
Sequence:CCGGGCAGCTACTTTGCCTGTGATTCTCGAGAATCACAGGCAAAGTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000404.1-1504s1c1
Sequence:CCGGCGTGTGAACTATGGTGCATATCTCGAGATATGCACCATAGTTCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000404.2-262s21c1
Sequence:CCGGCGCTACATCTCAGGAAGCATTCTCGAGAATGCTTCCTGAGATGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000404.2-686s21c1
Sequence:CCGGGCAGCTACTTTGCCTGTGATTCTCGAGAATCACAGGCAAAGTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000404.2-1561s21c1
Sequence:CCGGCGTGTGAACTATGGTGCATATCTCGAGATATGCACCATAGTTCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000404.2-2183s21c1
Sequence:CCGGCCCTGAACATACCTCACAGATCTCGAGATCTGTGAGGTATGTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009752
VALIDATED
GLB1 MISSION shRNA Bacterial Glycerol Stock
galactosidase, beta 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-304s1c1
Sequence:CCGGGCTGAATGCTATCCAGATGTACTCGAGTACATCTGGATAGCATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-163s1c1
Sequence:CCGGGAGGACATTTAAGCTCGACTACTCGAGTAGTCGAGCTTAAATGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-839s1c1
Sequence:CCGGCAGAGGAAGTTTGAACCTAAACTCGAGTTTAGGTTCAAACTTCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-1128s1c1
Sequence:CCGGGAGAAGTCATTCAGATGTTTACTCGAGTAAACATCTGAATGACTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-2137s1c1
Sequence:CCGGGTGCTAGAATGGAAGCTACATCTCGAGATGTAGCTTCCATTCTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009752
VALIDATED
GLB1 MISSION shRNA shRNA Plasmid DNA
galactosidase, beta 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-304s1c1
Sequence:CCGGGCTGAATGCTATCCAGATGTACTCGAGTACATCTGGATAGCATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-163s1c1
Sequence:CCGGGAGGACATTTAAGCTCGACTACTCGAGTAGTCGAGCTTAAATGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-839s1c1
Sequence:CCGGCAGAGGAAGTTTGAACCTAAACTCGAGTTTAGGTTCAAACTTCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-1128s1c1
Sequence:CCGGGAGAAGTCATTCAGATGTTTACTCGAGTAAACATCTGAATGACTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-2137s1c1
Sequence:CCGGGTGCTAGAATGGAAGCTACATCTCGAGATGTAGCTTCCATTCTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009752
VALIDATED
GLB1 MISSION shRNA Lentiviral Transduction Particles
galactosidase, beta 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-304s1c1
Sequence:CCGGGCTGAATGCTATCCAGATGTACTCGAGTACATCTGGATAGCATTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-163s1c1
Sequence:CCGGGAGGACATTTAAGCTCGACTACTCGAGTAGTCGAGCTTAAATGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-839s1c1
Sequence:CCGGCAGAGGAAGTTTGAACCTAAACTCGAGTTTAGGTTCAAACTTCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-1128s1c1
Sequence:CCGGGAGAAGTCATTCAGATGTTTACTCGAGTAAACATCTGAATGACTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009752.1-2137s1c1
Sequence:CCGGGTGCTAGAATGGAAGCTACATCTCGAGATGTAGCTTCCATTCTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)