EMAIL THIS PAGE TO A FRIEND

GLRA2

glycine receptor, alpha 2

175 Gene Product Result for
Synonyms: GLR
Gene ID:
Human(2742) Summary: The glycine receptor consists of two subunits, alpha and beta, and acts as a pentamer. The protein encoded by this gene is an alpha subunit and can bind strychnine. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]
Mouse(237213) glycine receptor, alpha 2 subunit
Rat(24397) glycine receptor, alpha 2
sheep(101121658) glycine receptor, alpha 2
Domestic Rabbit(100348933) glycine receptor, alpha 2
domestic guinea pig(100715097) glycine receptor, alpha 2
naked mole-rat(101721983) glycine receptor, alpha 2
Zebrafish(793646) glycine receptor alpha 2
chicken(772019) glycine receptor, alpha 2
dog(491746) glycine receptor, alpha 2
Horse(100050723) glycine receptor, alpha 2
cow(537660) glycine receptor, alpha 2
domestic cat(101090333) glycine receptor, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Ligand

Product # Description Species Add to Cart
 
E7023 Ethyl alcohol, Pure 200 proof, for molecular biology human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183427 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183427 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183427 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002063 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061551 MISSION® esiRNA esiRNA human GLRA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001118885 Rosetta Predictions human pricing
NM_001118886 Rosetta Predictions human pricing
NM_002063 Rosetta Predictions human pricing
NM_012568 Rosetta Predictions rat pricing
XM_579336 Rosetta Predictions rat pricing
NM_183427 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001118885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327000 predicted 1392
2 SASI_Hs02_00327001 predicted 1006
3 SASI_Hs02_00327002 predicted 925
4 SASI_Hs02_00327003 predicted 910
5 SASI_Hs02_00327004 predicted 1054
6 SASI_Hs02_00327005 predicted 932
7 SASI_Hs02_00327006 predicted 1410
8 SASI_Hs02_00327007 predicted 1248
9 SASI_Hs02_00327008 predicted 1300
10 SASI_Hs02_00327009 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001118886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327010 predicted 1819
2 SASI_Hs02_00327011 predicted 1434
3 SASI_Hs02_00327012 predicted 1352
4 SASI_Hs02_00327013 predicted 1340
5 SASI_Hs02_00327014 predicted 1482
6 SASI_Hs02_00327015 predicted 1364
7 SASI_Hs02_00327016 predicted 1838
8 SASI_Hs02_00327017 predicted 1682
9 SASI_Hs02_00327018 predicted 1728
10 SASI_Hs02_00327019 predicted 1846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211608 predicted 1817
2 SASI_Hs01_00211609 predicted 1428
3 SASI_Hs02_00333121 predicted 1353
4 SASI_Hs01_00211610 predicted 1345
5 SASI_Hs01_00211612 predicted 1485
6 SASI_Hs02_00333122 predicted 1368
7 SASI_Hs01_00211615 predicted 1836
8 SASI_Hs01_00211616 predicted 1678
9 SASI_Hs02_00333123 predicted 1736
10 SASI_Hs02_00333124 predicted 1847
11 SASI_Hs01_00211611 predicted 1207
12 SASI_Hs01_00211613 predicted 870
13 SASI_Hs01_00211614 predicted 786
14 SASI_Hs01_00211617 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012568 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259682 predicted 932
2 SASI_Rn01_00095469 predicted 1624
3 SASI_Rn01_00095471 predicted 1069
4 SASI_Rn01_00095472 predicted 858
5 SASI_Rn01_00095473 predicted 1136
6 SASI_Rn01_00095474 predicted 1273
7 SASI_Rn01_00095475 predicted 1939
8 SASI_Rn01_00095476 predicted 724
9 SASI_Rn01_00095477 predicted 1109
10 SASI_Rn02_00259683 predicted 1311
11 SASI_Rn01_00095470 predicted 1238
12 SASI_Rn01_00095478 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00196883 predicted 1283
2 SASI_Rn01_00196884 predicted 891
3 SASI_Rn01_00196885 predicted 737
4 SASI_Rn01_00196886 predicted 794
5 SASI_Rn01_00196887 predicted 925
6 SASI_Rn01_00196888 predicted 1599
7 SASI_Rn01_00196889 predicted 679
8 SASI_Rn01_00196890 predicted 762
9 SASI_Rn01_00196891 predicted 930
10 SASI_Rn01_00196892 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183427 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108260 predicted 1189
2 SASI_Mm01_00108261 predicted 638
3 SASI_Mm01_00108262 predicted 695
4 SASI_Mm01_00108263 predicted 1495
5 SASI_Mm01_00108264 predicted 447
6 SASI_Mm01_00108265 predicted 1331
7 SASI_Mm01_00108266 predicted 282
8 SASI_Mm01_00108267 predicted 671
9 SASI_Mm01_00108268 predicted 469
10 SASI_Mm01_00108269 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183427
GLRA2 MISSION shRNA Bacterial Glycerol Stock
glycine receptor, alpha 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183427.1-2188s1c1
Sequence:CCGGGCGTAATTGATTTACTGGTATCTCGAGATACCAGTAAATCAATTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183427.1-242s1c1
Sequence:CCGGCCTTCAGATTTCTTGGATAAACTCGAGTTTATCCAAGAAATCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183427.1-902s1c1
Sequence:CCGGCCCAGCCTGTTGATAGTCATTCTCGAGAATGACTATCAACAGGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183427.1-448s1c1
Sequence:CCGGCCCAGATGATTCCCTGGATTTCTCGAGAAATCCAGGGAATCATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183427.1-473s1c1
Sequence:CCGGCCCTCAATGTTGGATTCGATTCTCGAGAATCGAATCCAACATTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183427
GLRA2 MISSION shRNA shRNA Plasmid DNA
glycine receptor, alpha 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183427.1-2188s1c1
Sequence:CCGGGCGTAATTGATTTACTGGTATCTCGAGATACCAGTAAATCAATTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183427.1-242s1c1
Sequence:CCGGCCTTCAGATTTCTTGGATAAACTCGAGTTTATCCAAGAAATCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183427.1-902s1c1
Sequence:CCGGCCCAGCCTGTTGATAGTCATTCTCGAGAATGACTATCAACAGGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183427.1-448s1c1
Sequence:CCGGCCCAGATGATTCCCTGGATTTCTCGAGAAATCCAGGGAATCATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183427.1-473s1c1
Sequence:CCGGCCCTCAATGTTGGATTCGATTCTCGAGAATCGAATCCAACATTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183427
GLRA2 MISSION shRNA Lentiviral Transduction Particles
glycine receptor, alpha 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183427.1-2188s1c1
Sequence:CCGGGCGTAATTGATTTACTGGTATCTCGAGATACCAGTAAATCAATTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183427.1-242s1c1
Sequence:CCGGCCTTCAGATTTCTTGGATAAACTCGAGTTTATCCAAGAAATCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183427.1-902s1c1
Sequence:CCGGCCCAGCCTGTTGATAGTCATTCTCGAGAATGACTATCAACAGGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183427.1-448s1c1
Sequence:CCGGCCCAGATGATTCCCTGGATTTCTCGAGAAATCCAGGGAATCATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183427.1-473s1c1
Sequence:CCGGCCCTCAATGTTGGATTCGATTCTCGAGAATCGAATCCAACATTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002063
GLRA2 MISSION shRNA Bacterial Glycerol Stock
glycine receptor, alpha 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-1743s1c1
Sequence:CCGGGATGCTATCAAGAAGAAGTTTCTCGAGAAACTTCTTCTTGATAGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-649s1c1
Sequence:CCGGAGACCCTATCTCCTTCAGATTCTCGAGAATCTGAAGGAGATAGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-1125s1c1
Sequence:CCGGGACCTGATATTTGAGTGGTTACTCGAGTAACCACTCAAATATCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-1232s1c1
Sequence:CCGGGCACTACAACACTGGAAAGTTCTCGAGAACTTTCCAGTGTTGTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-1454s1c1
Sequence:CCGGGCCAAAGGTCTCCTATGTAAACTCGAGTTTACATAGGAGACCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002063
GLRA2 MISSION shRNA shRNA Plasmid DNA
glycine receptor, alpha 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-1743s1c1
Sequence:CCGGGATGCTATCAAGAAGAAGTTTCTCGAGAAACTTCTTCTTGATAGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-649s1c1
Sequence:CCGGAGACCCTATCTCCTTCAGATTCTCGAGAATCTGAAGGAGATAGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-1125s1c1
Sequence:CCGGGACCTGATATTTGAGTGGTTACTCGAGTAACCACTCAAATATCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-1232s1c1
Sequence:CCGGGCACTACAACACTGGAAAGTTCTCGAGAACTTTCCAGTGTTGTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-1454s1c1
Sequence:CCGGGCCAAAGGTCTCCTATGTAAACTCGAGTTTACATAGGAGACCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002063
GLRA2 MISSION shRNA Lentiviral Transduction Particles
glycine receptor, alpha 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-1743s1c1
Sequence:CCGGGATGCTATCAAGAAGAAGTTTCTCGAGAAACTTCTTCTTGATAGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-649s1c1
Sequence:CCGGAGACCCTATCTCCTTCAGATTCTCGAGAATCTGAAGGAGATAGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-1125s1c1
Sequence:CCGGGACCTGATATTTGAGTGGTTACTCGAGTAACCACTCAAATATCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-1232s1c1
Sequence:CCGGGCACTACAACACTGGAAAGTTCTCGAGAACTTTCCAGTGTTGTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002063.2-1454s1c1
Sequence:CCGGGCCAAAGGTCTCCTATGTAAACTCGAGTTTACATAGGAGACCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)