EMAIL THIS PAGE TO A FRIEND

GLT1D1

glycosyltransferase 1 domain containing 1

63 Gene Product Result for
UniProtKB ID: Q96MS3, Q86XG8
Gene ID:
Mouse(319804) glycosyltransferase 1 domain containing 1
Rat(304445) glycosyltransferase 1 domain containing 1
chicken(416807) glycosyltransferase 1 domain containing 1
domestic cat(101081677) glycosyltransferase 1 domain containing 1
cow(516510) glycosyltransferase 1 domain containing 1
dog(610050) glycosyltransferase 1 domain containing 1
sheep(101114727) glycosyltransferase 1 domain containing 1
domestic guinea pig(100729208) glycosyltransferase 1 domain containing 1
naked mole-rat(101706450) glycosyltransferase 1 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177005 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177005 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177005 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144669 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144669 Rosetta Predictions human pricing
XM_001073476 Rosetta Predictions rat pricing
XM_222147 Rosetta Predictions rat pricing
NM_177005 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088869 predicted 702
2 SASI_Hs01_00088870 predicted 1001
3 SASI_Hs01_00088871 predicted 335
4 SASI_Hs01_00088873 predicted 587
5 SASI_Hs01_00088875 predicted 603
6 SASI_Hs01_00088876 predicted 429
7 SASI_Hs01_00088877 predicted 1003
8 SASI_Hs01_00088878 predicted 730
9 SASI_Hs02_00364562 predicted 287
10 SASI_Hs02_00364563 predicted 1008
11 SASI_Hs01_00088872 predicted 439
12 SASI_Hs01_00088874 predicted 390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073476 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342976 predicted 783
2 SASI_Rn02_00342977 predicted 480
3 SASI_Rn02_00342978 predicted 522
4 SASI_Rn02_00342979 predicted 400
5 SASI_Rn02_00342980 predicted 429
6 SASI_Rn02_00342981 predicted 514
7 SASI_Rn02_00342982 predicted 464
8 SASI_Rn02_00342983 predicted 265
9 SASI_Rn02_00342984 predicted 550
10 SASI_Rn02_00342985 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380565 predicted 780
2 SASI_Rn02_00380566 predicted 791
3 SASI_Rn02_00380567 predicted 794
4 SASI_Rn02_00380568 predicted 798
5 SASI_Rn02_00380569 predicted 720
6 SASI_Rn02_00380570 predicted 712
7 SASI_Rn02_00380571 predicted 804
8 SASI_Rn02_00380572 predicted 731
9 SASI_Rn02_00380573 predicted 830
10 SASI_Rn02_00380574 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177005 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197755 predicted 597
2 SASI_Mm02_00346957 predicted 1045
3 SASI_Mm01_00197757 predicted 550
4 SASI_Mm02_00346958 predicted 421
5 SASI_Mm02_00346959 predicted 642
6 SASI_Mm02_00346960 predicted 509
7 SASI_Mm01_00197760 predicted 398
8 SASI_Mm02_00346961 predicted 970
9 SASI_Mm02_00346962 predicted 917
10 SASI_Mm02_00346963 predicted 353
11 SASI_Mm01_00197754 predicted 594
12 SASI_Mm01_00197756 predicted 643
13 SASI_Mm01_00197758 predicted 558
14 SASI_Mm01_00197759 predicted 671
15 SASI_Mm01_00197761 predicted 268
16 SASI_Mm01_00197762 predicted 629
17 SASI_Mm01_00197763 predicted 388
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177005
GLT1D1 MISSION shRNA Bacterial Glycerol Stock
glycosyltransferase 1 domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177005.2-1523s1c1
Sequence:CCGGCGGCTCTGAAAGAAGTTGATTCTCGAGAATCAACTTCTTTCAGAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177005.2-231s1c1
Sequence:CCGGCTTCTGCAAGGTCACAGCATTCTCGAGAATGCTGTGACCTTGCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177005.2-444s1c1
Sequence:CCGGGCAGGGAGAACTAGAATGTGTCTCGAGACACATTCTAGTTCTCCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177005.2-279s1c1
Sequence:CCGGGACTTAAATGAAGATGCCAATCTCGAGATTGGCATCTTCATTTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177005.4-1293s21c1
Sequence:CCGGACTCAGTCCCAGAGGTGTTTACTCGAGTAAACACCTCTGGGACTGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177005.4-793s21c1
Sequence:CCGGCATCTTGGAGGCAATGGATTTCTCGAGAAATCCATTGCCTCCAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177005.4-402s21c1
Sequence:CCGGATGCAACTGGGAAGATCTTTGCTCGAGCAAAGATCTTCCCAGTTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177005.4-1044s21c1
Sequence:CCGGAGACGAACTTGGAGGATTAAACTCGAGTTTAATCCTCCAAGTTCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177005
GLT1D1 MISSION shRNA shRNA Plasmid DNA
glycosyltransferase 1 domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177005.2-1523s1c1
Sequence:CCGGCGGCTCTGAAAGAAGTTGATTCTCGAGAATCAACTTCTTTCAGAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177005.2-231s1c1
Sequence:CCGGCTTCTGCAAGGTCACAGCATTCTCGAGAATGCTGTGACCTTGCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177005.2-444s1c1
Sequence:CCGGGCAGGGAGAACTAGAATGTGTCTCGAGACACATTCTAGTTCTCCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177005.2-279s1c1
Sequence:CCGGGACTTAAATGAAGATGCCAATCTCGAGATTGGCATCTTCATTTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177005.4-1293s21c1
Sequence:CCGGACTCAGTCCCAGAGGTGTTTACTCGAGTAAACACCTCTGGGACTGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177005.4-793s21c1
Sequence:CCGGCATCTTGGAGGCAATGGATTTCTCGAGAAATCCATTGCCTCCAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177005.4-402s21c1
Sequence:CCGGATGCAACTGGGAAGATCTTTGCTCGAGCAAAGATCTTCCCAGTTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177005.4-1044s21c1
Sequence:CCGGAGACGAACTTGGAGGATTAAACTCGAGTTTAATCCTCCAAGTTCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177005
GLT1D1 MISSION shRNA Lentiviral Transduction Particles
glycosyltransferase 1 domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177005.2-1523s1c1
Sequence:CCGGCGGCTCTGAAAGAAGTTGATTCTCGAGAATCAACTTCTTTCAGAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177005.2-231s1c1
Sequence:CCGGCTTCTGCAAGGTCACAGCATTCTCGAGAATGCTGTGACCTTGCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177005.2-444s1c1
Sequence:CCGGGCAGGGAGAACTAGAATGTGTCTCGAGACACATTCTAGTTCTCCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177005.2-279s1c1
Sequence:CCGGGACTTAAATGAAGATGCCAATCTCGAGATTGGCATCTTCATTTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443291    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177005.4-1293s21c1
Sequence:CCGGACTCAGTCCCAGAGGTGTTTACTCGAGTAAACACCTCTGGGACTGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177005.4-793s21c1
Sequence:CCGGCATCTTGGAGGCAATGGATTTCTCGAGAAATCCATTGCCTCCAAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177005.4-402s21c1
Sequence:CCGGATGCAACTGGGAAGATCTTTGCTCGAGCAAAGATCTTCCCAGTTGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177005.4-1044s21c1
Sequence:CCGGAGACGAACTTGGAGGATTAAACTCGAGTTTAATCCTCCAAGTTCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144669
GLT1D1 MISSION shRNA Bacterial Glycerol Stock
glycosyltransferase 1 domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144669.1-385s1c1
Sequence:CCGGCACAGAGTCAATGAAGGAAATCTCGAGATTTCCTTCATTGACTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144669.1-1828s1c1
Sequence:CCGGCCTCCACTGAATACTGAAATTCTCGAGAATTTCAGTATTCAGTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148269    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144669.1-2228s1c1
Sequence:CCGGGCCTCCATCATGTAATAGAATCTCGAGATTCTATTACATGATGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144669.1-1168s21c1
Sequence:CCGGGTGGACAATAGAGGCTTATTTCTCGAGAAATAAGCCTCTATTGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144669.1-760s21c1
Sequence:CCGGATACGTGAGAATGTATCATTCCTCGAGGAATGATACATTCTCACGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144669.1-592s21c1
Sequence:CCGGGGATTTAGAAGTACCGGTATTCTCGAGAATACCGGTACTTCTAAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144669.1-377s21c1
Sequence:CCGGGTCGCTTTCACAGAGTCAATGCTCGAGCATTGACTCTGTGAAAGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144669.1-711s21c1
Sequence:CCGGTGGTTAGTGATCCTGCATTAGCTCGAGCTAATGCAGGATCACTAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144669
GLT1D1 MISSION shRNA shRNA Plasmid DNA
glycosyltransferase 1 domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144669.1-385s1c1
Sequence:CCGGCACAGAGTCAATGAAGGAAATCTCGAGATTTCCTTCATTGACTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144669.1-1828s1c1
Sequence:CCGGCCTCCACTGAATACTGAAATTCTCGAGAATTTCAGTATTCAGTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148269    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144669.1-2228s1c1
Sequence:CCGGGCCTCCATCATGTAATAGAATCTCGAGATTCTATTACATGATGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144669.1-1168s21c1
Sequence:CCGGGTGGACAATAGAGGCTTATTTCTCGAGAAATAAGCCTCTATTGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144669.1-760s21c1
Sequence:CCGGATACGTGAGAATGTATCATTCCTCGAGGAATGATACATTCTCACGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144669.1-592s21c1
Sequence:CCGGGGATTTAGAAGTACCGGTATTCTCGAGAATACCGGTACTTCTAAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144669.1-377s21c1
Sequence:CCGGGTCGCTTTCACAGAGTCAATGCTCGAGCATTGACTCTGTGAAAGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144669.1-711s21c1
Sequence:CCGGTGGTTAGTGATCCTGCATTAGCTCGAGCTAATGCAGGATCACTAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144669
GLT1D1 MISSION shRNA Lentiviral Transduction Particles
glycosyltransferase 1 domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150003    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144669.1-385s1c1
Sequence:CCGGCACAGAGTCAATGAAGGAAATCTCGAGATTTCCTTCATTGACTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144669.1-1828s1c1
Sequence:CCGGCCTCCACTGAATACTGAAATTCTCGAGAATTTCAGTATTCAGTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148269    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144669.1-2228s1c1
Sequence:CCGGGCCTCCATCATGTAATAGAATCTCGAGATTCTATTACATGATGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244005    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144669.1-1168s21c1
Sequence:CCGGGTGGACAATAGAGGCTTATTTCTCGAGAAATAAGCCTCTATTGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144669.1-760s21c1
Sequence:CCGGATACGTGAGAATGTATCATTCCTCGAGGAATGATACATTCTCACGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144669.1-592s21c1
Sequence:CCGGGGATTTAGAAGTACCGGTATTCTCGAGAATACCGGTACTTCTAAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144669.1-377s21c1
Sequence:CCGGGTCGCTTTCACAGAGTCAATGCTCGAGCATTGACTCTGTGAAAGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144669.1-711s21c1
Sequence:CCGGTGGTTAGTGATCCTGCATTAGCTCGAGCTAATGCAGGATCACTAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)