EMAIL THIS PAGE TO A FRIEND

GLT25D1

10 Gene Product Result for
Gene ID:
sheep(101114107) glycosyltransferase 25 domain containing 1
dog(484834) glycosyltransferase 25 domain containing 1
domestic cat(101091350) glycosyltransferase 25 domain containing 1
Horse(100070236) glycosyltransferase 25 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146211 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146211 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146211 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_146211 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136482 predicted 1452
2 SASI_Mm01_00136483 predicted 1727
3 SASI_Mm01_00136484 predicted 628
4 SASI_Mm01_00136485 predicted 479
5 SASI_Mm01_00136486 predicted 2015
6 SASI_Mm01_00136487 predicted 1135
7 SASI_Mm01_00136488 predicted 1881
8 SASI_Mm01_00136489 predicted 642
9 SASI_Mm01_00136490 predicted 2099
10 SASI_Mm01_00136491 predicted 1721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146211
VALIDATED
GLT25D1 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146211.1-1685s1c1
Sequence:CCGGGCCTATGTAATCTCCCTGCAACTCGAGTTGCAGGGAGATTACATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146211.1-2477s1c1
Sequence:CCGGGCTCTGGGAATACTGAAATAACTCGAGTTATTTCAGTATTCCCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146211.1-1036s1c1
Sequence:CCGGCGTGTGCAATAAGGAGGTGTACTCGAGTACACCTCCTTATTGCACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146211.1-2867s1c1
Sequence:CCGGGCTGGGTTCAAGGATACTCATCTCGAGATGAGTATCCTTGAACCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146211.1-476s1c1
Sequence:CCGGGACAACACTTCAGCCATACTTCTCGAGAAGTATGGCTGAAGTGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146211
VALIDATED
GLT25D1 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146211.1-1685s1c1
Sequence:CCGGGCCTATGTAATCTCCCTGCAACTCGAGTTGCAGGGAGATTACATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146211.1-2477s1c1
Sequence:CCGGGCTCTGGGAATACTGAAATAACTCGAGTTATTTCAGTATTCCCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146211.1-1036s1c1
Sequence:CCGGCGTGTGCAATAAGGAGGTGTACTCGAGTACACCTCCTTATTGCACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146211.1-2867s1c1
Sequence:CCGGGCTGGGTTCAAGGATACTCATCTCGAGATGAGTATCCTTGAACCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146211.1-476s1c1
Sequence:CCGGGACAACACTTCAGCCATACTTCTCGAGAAGTATGGCTGAAGTGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146211
VALIDATED
GLT25D1 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146211.1-1685s1c1
Sequence:CCGGGCCTATGTAATCTCCCTGCAACTCGAGTTGCAGGGAGATTACATAGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183637    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146211.1-2477s1c1
Sequence:CCGGGCTCTGGGAATACTGAAATAACTCGAGTTATTTCAGTATTCCCAGAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000195969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146211.1-1036s1c1
Sequence:CCGGCGTGTGCAATAAGGAGGTGTACTCGAGTACACCTCCTTATTGCACACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196085    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146211.1-2867s1c1
Sequence:CCGGGCTGGGTTCAAGGATACTCATCTCGAGATGAGTATCCTTGAACCCAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000179167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146211.1-476s1c1
Sequence:CCGGGACAACACTTCAGCCATACTTCTCGAGAAGTATGGCTGAAGTGTTGTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???