EMAIL THIS PAGE TO A FRIEND

Gm906

12 Gene Product Result for
Species: Mouse Gm906(380882)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033438 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033438 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033438 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU191581 MISSION® esiRNA targeting mouse Gm8700, Gm8765, Gm906 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020227 predicted 2807
2 SASI_Mm01_00020228 predicted 2739
3 SASI_Mm01_00020229 predicted 1646
4 SASI_Mm01_00020230 predicted 2845
5 SASI_Mm01_00020231 predicted 725
6 SASI_Mm01_00020232 predicted 2601
7 SASI_Mm01_00020233 predicted 1960
8 SASI_Mm01_00020234 predicted 1617
9 SASI_Mm01_00020235 predicted 1129
10 SASI_Mm02_00288759 predicted 1869
11 SASI_Mm01_00020226 predicted 637
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033438
Gm906 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-728s21c1
Sequence:CCGGTGGGAAACATGGACCATATTCCTCGAGGAATATGGTCCATGTTTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-2874s21c1
Sequence:CCGGAGAGCCTGTGACCCATATATGCTCGAGCATATATGGGTCACAGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-2269s21c1
Sequence:CCGGTCCTAGCTGATAAGATCAAAGCTCGAGCTTTGATCTTATCAGCTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-2465s21c1
Sequence:CCGGTCGGAAGAACACCTTACTTAACTCGAGTTAAGTAAGGTGTTCTTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-1946s21c1
Sequence:CCGGCATTGGTAAGCATATCGATATCTCGAGATATCGATATGCTTACCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033438
Gm906 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-728s21c1
Sequence:CCGGTGGGAAACATGGACCATATTCCTCGAGGAATATGGTCCATGTTTCCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000267331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-2874s21c1
Sequence:CCGGAGAGCCTGTGACCCATATATGCTCGAGCATATATGGGTCACAGGCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000267333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-2269s21c1
Sequence:CCGGTCCTAGCTGATAAGATCAAAGCTCGAGCTTTGATCTTATCAGCTAGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000267332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-2465s21c1
Sequence:CCGGTCGGAAGAACACCTTACTTAACTCGAGTTAAGTAAGGTGTTCTTCCGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000267330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-1946s21c1
Sequence:CCGGCATTGGTAAGCATATCGATATCTCGAGATATCGATATGCTTACCAATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033438
Gm906 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000267329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-728s21c1
Sequence:CCGGTGGGAAACATGGACCATATTCCTCGAGGAATATGGTCCATGTTTCCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-2874s21c1
Sequence:CCGGAGAGCCTGTGACCCATATATGCTCGAGCATATATGGGTCACAGGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-2269s21c1
Sequence:CCGGTCCTAGCTGATAAGATCAAAGCTCGAGCTTTGATCTTATCAGCTAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-2465s21c1
Sequence:CCGGTCGGAAGAACACCTTACTTAACTCGAGTTAAGTAAGGTGTTCTTCCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033438.2-1946s21c1
Sequence:CCGGCATTGGTAAGCATATCGATATCTCGAGATATCGATATGCTTACCAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)