EMAIL THIS PAGE TO A FRIEND

Gmcl1l

29 Gene Product Result for
Gene ID:
Rat(302575) germ cell-less homolog 1 (Drosophila)-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027955 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027955 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027955 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001065278 Rosetta Predictions rat pricing
XM_228797 Rosetta Predictions rat pricing
NM_027955 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313508 predicted 1267
2 SASI_Rn02_00313509 predicted 1204
3 SASI_Rn02_00313510 predicted 1102
4 SASI_Rn02_00313511 predicted 222
5 SASI_Rn02_00313512 predicted 1336
6 SASI_Rn02_00313513 predicted 1338
7 SASI_Rn02_00313514 predicted 1459
8 SASI_Rn02_00313515 predicted 1511
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385527 predicted 1265
2 SASI_Rn02_00385528 predicted 1207
3 SASI_Rn02_00385529 predicted 1106
4 SASI_Rn02_00385530 predicted 219
5 SASI_Rn02_00385531 predicted 1341
6 SASI_Rn02_00385532 predicted 1337
7 SASI_Rn02_00385533 predicted 1457
8 SASI_Rn02_00385534 predicted 1514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332970 predicted 280
2 SASI_Mm01_00118175 predicted 455
3 SASI_Mm02_00332971 predicted 986
4 SASI_Mm01_00118176 predicted 1468
5 SASI_Mm01_00118177 predicted 1063
6 SASI_Mm02_00332972 predicted 1112
7 SASI_Mm01_00118178 predicted 827
8 SASI_Mm01_00118179 predicted 762
9 SASI_Mm01_00118180 predicted 1041
10 SASI_Mm01_00118181 predicted 770
11 SASI_Mm01_00118172 predicted 453
12 SASI_Mm01_00118173 predicted 677
13 SASI_Mm01_00118174 predicted 1372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027955
Gmcl1l MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027955.1-1710s1c1
Sequence:CCGGCCATCACCTTATTTCCATGTACTCGAGTACATGGAAATAAGGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027955.1-598s1c1
Sequence:CCGGCGAGTAATTCAGCAGTGTGAACTCGAGTTCACACTGCTGAATTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027955.1-1504s1c1
Sequence:CCGGCCTATGTGTATATTCTGCAATCTCGAGATTGCAGAATATACACATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027955.1-324s1c1
Sequence:CCGGCGGGCATGATAGCGACATTAACTCGAGTTAATGTCGCTATCATGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027955.1-754s1c1
Sequence:CCGGGCACTTTACAAGGAAGTAGATCTCGAGATCTACTTCCTTGTAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027955
Gmcl1l MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027955.1-1710s1c1
Sequence:CCGGCCATCACCTTATTTCCATGTACTCGAGTACATGGAAATAAGGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027955.1-598s1c1
Sequence:CCGGCGAGTAATTCAGCAGTGTGAACTCGAGTTCACACTGCTGAATTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027955.1-1504s1c1
Sequence:CCGGCCTATGTGTATATTCTGCAATCTCGAGATTGCAGAATATACACATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027955.1-324s1c1
Sequence:CCGGCGGGCATGATAGCGACATTAACTCGAGTTAATGTCGCTATCATGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027955.1-754s1c1
Sequence:CCGGGCACTTTACAAGGAAGTAGATCTCGAGATCTACTTCCTTGTAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027955
Gmcl1l MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027955.1-1710s1c1
Sequence:CCGGCCATCACCTTATTTCCATGTACTCGAGTACATGGAAATAAGGTGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027955.1-598s1c1
Sequence:CCGGCGAGTAATTCAGCAGTGTGAACTCGAGTTCACACTGCTGAATTACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027955.1-1504s1c1
Sequence:CCGGCCTATGTGTATATTCTGCAATCTCGAGATTGCAGAATATACACATAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027955.1-324s1c1
Sequence:CCGGCGGGCATGATAGCGACATTAACTCGAGTTAATGTCGCTATCATGCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027955.1-754s1c1
Sequence:CCGGGCACTTTACAAGGAAGTAGATCTCGAGATCTACTTCCTTGTAAAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)