EMAIL THIS PAGE TO A FRIEND

GNAI2

guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2

89 Gene Product Result for
Synonyms: GIP GNAI2B H_LUCA15.1 H_LUCA16.1
UniProtKB ID: P04899, B4DYA0, Q6B6N3, Q8IZ71
Gene ID:
Human(2771) Summary: The protein encoded by this gene is an alpha subunit of guanine nucleotide binding proteins (G proteins). The encoded protein contains the guanine nucleotide binding site and is involved in the hormonal regulation of adenylate cyclase. Several transcript variants encoding different isoforms have been detected for this gene, but the full-length nature of only two are known so far. [provided by RefSeq, Oct 2009]
Mouse(14678) guanine nucleotide binding protein (G protein), alpha inhibiting 2
Rat(81664) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
domestic guinea pig(100135529) guanine nucleotide binding protein (G protein), alpha inhibiting 2
naked mole-rat(101698645) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
sheep(100302341) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
chicken(396367) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
cow(281791) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
Horse(100062085) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
domestic cat(100500724) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
domestic cat(101089679) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
dog(442957) guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
MAB3077 Anti-G Protein Giα-2 Antibody, clone L5 clone L5, Chemicon®, from mouse bovine, rat, human, guinea pig, mouse
western blot pricing
G4915 Anti-Gαi1,2 antibody produced in rabbit whole antiserum mammals
western blot pricing
05-1403 Anti-Giα2 Antibody, clone L5 clone L5, from mouse bovine, guinea pig, mouse (69%), human (62%), human, guinea pig (43%), bovine (100%), mouse, rat, rat (69%)
immunohistochemistry, western blot pricing
SAB2100938 Anti-GNAI2 (ab2) antibody produced in rabbit affinity isolated antibody horse, rat, sheep, mouse, guinea pig, human, bovine, rabbit, dog, goat
western blot pricing
HPA007704 Anti-GNAI2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
WH0002771M2 Monoclonal Anti-GNAI2 antibody produced in mouse clone 3G11, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002070 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002070 Rosetta Predictions human pricing
NM_031035 Rosetta Predictions rat pricing
NM_008138 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199944 predicted 317 154.00
2 SASI_Hs01_00199945 predicted 1109 154.00
3 SASI_Hs01_00199946 predicted 1070 154.00
4 SASI_Hs01_00199947 predicted 637 154.00
5 SASI_Hs01_00199948 predicted 852 154.00
6 SASI_Hs01_00199949 predicted 551 154.00
7 SASI_Hs01_00199950 predicted 533 154.00
8 SASI_Hs01_00199951 predicted 482 154.00
9 SASI_Hs01_00199952 predicted 1036 154.00
10 SASI_Hs01_00199953 predicted 969 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264239 predicted 693 154.00
2 SASI_Rn02_00264240 predicted 569 154.00
3 SASI_Rn02_00264241 predicted 629 154.00
4 SASI_Rn02_00264242 predicted 343 154.00
5 SASI_Rn02_00264243 predicted 645 154.00
6 SASI_Rn02_00264244 predicted 824 154.00
7 SASI_Rn02_00264245 predicted 635 154.00
8 SASI_Rn01_00119305 predicted 900 154.00
9 SASI_Rn01_00119307 predicted 595 154.00
10 SASI_Rn01_00119308 predicted 389 154.00
11 SASI_Rn01_00119302 predicted 1055 154.00
12 SASI_Rn01_00119303 predicted 679 154.00
13 SASI_Rn01_00119304 predicted 1059 154.00
14 SASI_Rn01_00119306 predicted 679 154.00
15 SASI_Rn01_00119309 predicted 597 154.00
16 SASI_Rn01_00119310 predicted 855 154.00
17 SASI_Rn01_00119311 predicted 591 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313219 predicted 577 154.00
2 SASI_Mm02_00313220 predicted 535 154.00
3 SASI_Mm02_00313221 predicted 1071 154.00
4 SASI_Mm02_00313222 predicted 614 154.00
5 SASI_Mm01_00051290 predicted 584 154.00
6 SASI_Mm01_00051292 predicted 620 154.00
7 SASI_Mm02_00313223 predicted 1494 154.00
8 SASI_Mm01_00051296 predicted 535 154.00
9 SASI_Mm01_00051297 predicted 567 154.00
10 SASI_Mm02_00313224 predicted 604 154.00
11 SASI_Mm01_00051289 predicted 1096 154.00
12 SASI_Mm01_00051291 predicted 689 154.00
13 SASI_Mm01_00051293 predicted 1032 154.00
14 SASI_Mm01_00051294 predicted 1044 154.00
15 SASI_Mm01_00051295 predicted 683 154.00
16 SASI_Mm01_00051298 predicted 1068 154.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002070
VALIDATED
GNAI2 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002070.1-870s1c1
Sequence:CCGGGCTATTCGATAGCATCTGCAACTCGAGTTGCAGATGCTATCGAATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002070.1-165s1c1
Sequence:CCGGGCGCTCTAAGATGATCGACAACTCGAGTTGTCGATCATCTTAGAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002070.1-1143s1c1
Sequence:CCGGCACCGATGTCATCATCAAGAACTCGAGTTCTTGATGATGACATCGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002070.1-1035s1c1
Sequence:CCGGCCAGAGTAAGTTTGAGGACCTCTCGAGAGGTCCTCAAACTTACTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002070.1-855s1c1
Sequence:CCGGGCATGAGAGCATGAAGCTATTCTCGAGAATAGCTTCATGCTCTCATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-163s21c1
Sequence:CCGGGCGCTCTAAGATGATCGACAACTCGAGTTGTCGATCATCTTAGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-1141s21c1
Sequence:CCGGCACCGATGTCATCATCAAGAACTCGAGTTCTTGATGATGACATCGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-868s21c1
Sequence:CCGGGCTATTCGATAGCATCTGCAACTCGAGTTGCAGATGCTATCGAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-1033s21c1
Sequence:CCGGCCAGAGTAAGTTTGAGGACCTCTCGAGAGGTCCTCAAACTTACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-853s21c1
Sequence:CCGGGCATGAGAGCATGAAGCTATTCTCGAGAATAGCTTCATGCTCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002070
VALIDATED
GNAI2 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002070.1-870s1c1
Sequence:CCGGGCTATTCGATAGCATCTGCAACTCGAGTTGCAGATGCTATCGAATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002070.1-165s1c1
Sequence:CCGGGCGCTCTAAGATGATCGACAACTCGAGTTGTCGATCATCTTAGAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002070.1-1143s1c1
Sequence:CCGGCACCGATGTCATCATCAAGAACTCGAGTTCTTGATGATGACATCGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002070.1-1035s1c1
Sequence:CCGGCCAGAGTAAGTTTGAGGACCTCTCGAGAGGTCCTCAAACTTACTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002070.1-855s1c1
Sequence:CCGGGCATGAGAGCATGAAGCTATTCTCGAGAATAGCTTCATGCTCTCATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-163s21c1
Sequence:CCGGGCGCTCTAAGATGATCGACAACTCGAGTTGTCGATCATCTTAGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-1141s21c1
Sequence:CCGGCACCGATGTCATCATCAAGAACTCGAGTTCTTGATGATGACATCGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-868s21c1
Sequence:CCGGGCTATTCGATAGCATCTGCAACTCGAGTTGCAGATGCTATCGAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-1033s21c1
Sequence:CCGGCCAGAGTAAGTTTGAGGACCTCTCGAGAGGTCCTCAAACTTACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-853s21c1
Sequence:CCGGGCATGAGAGCATGAAGCTATTCTCGAGAATAGCTTCATGCTCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002070
VALIDATED
GNAI2 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_002070.1-870s1c1
Sequence:CCGGGCTATTCGATAGCATCTGCAACTCGAGTTGCAGATGCTATCGAATAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002070.1-165s1c1
Sequence:CCGGGCGCTCTAAGATGATCGACAACTCGAGTTGTCGATCATCTTAGAGCGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002070.1-1143s1c1
Sequence:CCGGCACCGATGTCATCATCAAGAACTCGAGTTCTTGATGATGACATCGGTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002070.1-1035s1c1
Sequence:CCGGCCAGAGTAAGTTTGAGGACCTCTCGAGAGGTCCTCAAACTTACTCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002070.1-855s1c1
Sequence:CCGGGCATGAGAGCATGAAGCTATTCTCGAGAATAGCTTCATGCTCTCATGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-163s21c1
Sequence:CCGGGCGCTCTAAGATGATCGACAACTCGAGTTGTCGATCATCTTAGAGCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-1141s21c1
Sequence:CCGGCACCGATGTCATCATCAAGAACTCGAGTTCTTGATGATGACATCGGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-868s21c1
Sequence:CCGGGCTATTCGATAGCATCTGCAACTCGAGTTGCAGATGCTATCGAATAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-1033s21c1
Sequence:CCGGCCAGAGTAAGTTTGAGGACCTCTCGAGAGGTCCTCAAACTTACTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002070.2-853s21c1
Sequence:CCGGGCATGAGAGCATGAAGCTATTCTCGAGAATAGCTTCATGCTCTCATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008138
GNAI2 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008138.2-1776s1c1
Sequence:CCGGCCTGCTCATTCTCGTAGCTTTCTCGAGAAAGCTACGAGAATGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008138.2-569s1c1
Sequence:CCGGGCCGCTTACTACCTGAATGATCTCGAGATCATTCAGGTAGTAAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008138.2-541s1c1
Sequence:CCGGCTCACGAGAATACCAGCTCAACTCGAGTTGAGCTGGTATTCTCGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008138.2-1037s1c1
Sequence:CCGGGAGGATCTAAATAAGCGCAAACTCGAGTTTGCGCTTATTTAGATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008138.2-209s1c1
Sequence:CCGGGAGGTGAAGTTGCTTCTGTTACTCGAGTAACAGAAGCAACTTCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008138.4-798s21c1
Sequence:CCGGTGTGTCGCCTTGAGCGCTTATCTCGAGATAAGCGCTCAAGGCGACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008138.4-1041s21c1
Sequence:CCGGAGCAAGTTTGAGGATCTAAATCTCGAGATTTAGATCCTCAAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008138.4-545s21c1
Sequence:CCGGCTTTGGCCGCTCACGAGAATACTCGAGTATTCTCGTGAGCGGCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008138.4-391s21c1
Sequence:CCGGGCAACCTGCAGATCGACTTTGCTCGAGCAAAGTCGATCTGCAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008138
GNAI2 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008138.2-1776s1c1
Sequence:CCGGCCTGCTCATTCTCGTAGCTTTCTCGAGAAAGCTACGAGAATGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008138.2-569s1c1
Sequence:CCGGGCCGCTTACTACCTGAATGATCTCGAGATCATTCAGGTAGTAAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008138.2-541s1c1
Sequence:CCGGCTCACGAGAATACCAGCTCAACTCGAGTTGAGCTGGTATTCTCGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008138.2-1037s1c1
Sequence:CCGGGAGGATCTAAATAAGCGCAAACTCGAGTTTGCGCTTATTTAGATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008138.2-209s1c1
Sequence:CCGGGAGGTGAAGTTGCTTCTGTTACTCGAGTAACAGAAGCAACTTCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008138.4-798s21c1
Sequence:CCGGTGTGTCGCCTTGAGCGCTTATCTCGAGATAAGCGCTCAAGGCGACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008138.4-1041s21c1
Sequence:CCGGAGCAAGTTTGAGGATCTAAATCTCGAGATTTAGATCCTCAAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008138.4-545s21c1
Sequence:CCGGCTTTGGCCGCTCACGAGAATACTCGAGTATTCTCGTGAGCGGCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008138.4-391s21c1
Sequence:CCGGGCAACCTGCAGATCGACTTTGCTCGAGCAAAGTCGATCTGCAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008138
GNAI2 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008138.2-1776s1c1
Sequence:CCGGCCTGCTCATTCTCGTAGCTTTCTCGAGAAAGCTACGAGAATGAGCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008138.2-569s1c1
Sequence:CCGGGCCGCTTACTACCTGAATGATCTCGAGATCATTCAGGTAGTAAGCGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008138.2-541s1c1
Sequence:CCGGCTCACGAGAATACCAGCTCAACTCGAGTTGAGCTGGTATTCTCGTGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008138.2-1037s1c1
Sequence:CCGGGAGGATCTAAATAAGCGCAAACTCGAGTTTGCGCTTATTTAGATCCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000054735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008138.2-209s1c1
Sequence:CCGGGAGGTGAAGTTGCTTCTGTTACTCGAGTAACAGAAGCAACTTCACCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000362507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008138.4-798s21c1
Sequence:CCGGTGTGTCGCCTTGAGCGCTTATCTCGAGATAAGCGCTCAAGGCGACACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000362428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008138.4-1041s21c1
Sequence:CCGGAGCAAGTTTGAGGATCTAAATCTCGAGATTTAGATCCTCAAACTTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000362429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008138.4-545s21c1
Sequence:CCGGCTTTGGCCGCTCACGAGAATACTCGAGTATTCTCGTGAGCGGCCAAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000362427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008138.4-391s21c1
Sequence:CCGGGCAACCTGCAGATCGACTTTGCTCGAGCAAAGTCGATCTGCAGGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???