EMAIL THIS PAGE TO A FRIEND

GNAQ

guanine nucleotide binding protein (G protein), q polypeptide

69 Gene Product Result for
Synonyms: CMC1 G-ALPHA-q GAQ SWS
UniProtKB ID: P50148, O15108, Q13462, Q6NT27, Q92471, Q9BZB9
Gene ID:
Human(2776) Summary: This locus encodes a guanine nucleotide-binding protein. The encoded protein, an alpha subunit in the Gq class, couples a seven-transmembrane domain receptor to activation of phospolipase C-beta. Mutations at this locus have been associated with problems in platelet activation and aggregation. A related pseudogene exists on chromosome 2.[provided by RefSeq, Nov 2010]
Mouse(14682) guanine nucleotide binding protein, alpha q polypeptide
Rat(81666) guanine nucleotide binding protein (G protein), q polypeptide
Zebrafish(570108) guanine nucleotide binding protein (G protein), q polypeptide
chicken(427262) guanine nucleotide binding protein (G protein), q polypeptide
domestic cat(101094708) guanine nucleotide binding protein (G protein), q polypeptide
cow(536654) guanine nucleotide binding protein (G protein), q polypeptide
dog(403928) guanine nucleotide binding protein (G protein), q polypeptide
domestic guinea pig(100714586) guanine nucleotide binding protein (G protein), q polypeptide
naked mole-rat(101715420) guanine nucleotide binding protein (G protein), q polypeptide
sheep(101112295) guanine nucleotide binding protein (G protein), q polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008139 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008139 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008139 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002072 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002072 Rosetta Predictions human pricing
NM_031036 Rosetta Predictions rat pricing
NM_008139 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231792 predicted 322
2 SASI_Hs01_00231793 predicted 354
3 SASI_Hs01_00231794 predicted 762
4 SASI_Hs01_00231795 predicted 780
5 SASI_Hs01_00231796 predicted 437
6 SASI_Hs01_00231797 predicted 562
7 SASI_Hs01_00231798 predicted 797
8 SASI_Hs01_00231799 predicted 709
9 SASI_Hs01_00231800 predicted 620
10 SASI_Hs02_00333145 predicted 234
11 SASI_Hs01_00231801 predicted 1102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115988 predicted 306
2 SASI_Rn01_00115989 predicted 384
3 SASI_Rn01_00115990 predicted 288
4 SASI_Rn01_00115991 predicted 721
5 SASI_Rn01_00115992 predicted 573
6 SASI_Rn01_00115993 predicted 370
7 SASI_Rn01_00115994 predicted 273
8 SASI_Rn02_00264246 predicted 775
9 SASI_Rn01_00115995 predicted 409
10 SASI_Rn01_00115996 predicted 465
11 SASI_Rn01_00115987 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127577 predicted 777
2 SASI_Mm01_00127578 predicted 940
3 SASI_Mm01_00127579 predicted 1184
4 SASI_Mm01_00127580 predicted 807
5 SASI_Mm01_00127581 predicted 1246
6 SASI_Mm02_00313225 predicted 784
7 SASI_Mm01_00127582 predicted 1074
8 SASI_Mm01_00127583 predicted 1176
9 SASI_Mm01_00127584 predicted 865
10 SASI_Mm01_00127585 predicted 952
11 SASI_Mm01_00127586 predicted 1241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008139
VALIDATED
GNAQ MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), q polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008139.2-2302s1c1
Sequence:CCGGGCCCTCTTGTAGCTTCTTTATCTCGAGATAAAGAAGCTACAAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008139.2-929s1c1
Sequence:CCGGCTTAGCGAATATGATCAAGTTCTCGAGAACTTGATCATATTCGCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008139.2-636s1c1
Sequence:CCGGGCTTGTGGAATGATCCTGGAACTCGAGTTCCAGGATCATTCCACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008139.2-743s1c1
Sequence:CCGGCCTTCCTATCTGCCTACACAACTCGAGTTGTGTAGGCAGATAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008139.2-1148s1c1
Sequence:CCGGGCTCGAGAATTCATCCTGAAACTCGAGTTTCAGGATGAATTCTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-2561s21c1
Sequence:CCGGGCCCTCTTGTAGCTTCTTTATCTCGAGATAAAGAAGCTACAAGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-896s21c1
Sequence:CCGGGCTTGTGGAATGATCCTGGAACTCGAGTTCCAGGATCATTCCACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-1408s21c1
Sequence:CCGGGCTCGAGAATTCATCCTGAAACTCGAGTTTCAGGATGAATTCTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-1050s21c1
Sequence:CCGGCACTACAGGGATCATCGAATACTCGAGTATTCGATGATCCCTGTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-928s21c1
Sequence:CCGGTACGACAGACGACGGGAATATCTCGAGATATTCCCGTCGTCTGTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008139
VALIDATED
GNAQ MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), q polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008139.2-2302s1c1
Sequence:CCGGGCCCTCTTGTAGCTTCTTTATCTCGAGATAAAGAAGCTACAAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008139.2-929s1c1
Sequence:CCGGCTTAGCGAATATGATCAAGTTCTCGAGAACTTGATCATATTCGCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008139.2-636s1c1
Sequence:CCGGGCTTGTGGAATGATCCTGGAACTCGAGTTCCAGGATCATTCCACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008139.2-743s1c1
Sequence:CCGGCCTTCCTATCTGCCTACACAACTCGAGTTGTGTAGGCAGATAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008139.2-1148s1c1
Sequence:CCGGGCTCGAGAATTCATCCTGAAACTCGAGTTTCAGGATGAATTCTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-2561s21c1
Sequence:CCGGGCCCTCTTGTAGCTTCTTTATCTCGAGATAAAGAAGCTACAAGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-896s21c1
Sequence:CCGGGCTTGTGGAATGATCCTGGAACTCGAGTTCCAGGATCATTCCACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-1408s21c1
Sequence:CCGGGCTCGAGAATTCATCCTGAAACTCGAGTTTCAGGATGAATTCTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-1050s21c1
Sequence:CCGGCACTACAGGGATCATCGAATACTCGAGTATTCGATGATCCCTGTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-928s21c1
Sequence:CCGGTACGACAGACGACGGGAATATCTCGAGATATTCCCGTCGTCTGTCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008139
VALIDATED
GNAQ MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), q polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008139.2-2302s1c1
Sequence:CCGGGCCCTCTTGTAGCTTCTTTATCTCGAGATAAAGAAGCTACAAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008139.2-929s1c1
Sequence:CCGGCTTAGCGAATATGATCAAGTTCTCGAGAACTTGATCATATTCGCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008139.2-636s1c1
Sequence:CCGGGCTTGTGGAATGATCCTGGAACTCGAGTTCCAGGATCATTCCACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008139.2-743s1c1
Sequence:CCGGCCTTCCTATCTGCCTACACAACTCGAGTTGTGTAGGCAGATAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008139.2-1148s1c1
Sequence:CCGGGCTCGAGAATTCATCCTGAAACTCGAGTTTCAGGATGAATTCTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-2561s21c1
Sequence:CCGGGCCCTCTTGTAGCTTCTTTATCTCGAGATAAAGAAGCTACAAGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-896s21c1
Sequence:CCGGGCTTGTGGAATGATCCTGGAACTCGAGTTCCAGGATCATTCCACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-1408s21c1
Sequence:CCGGGCTCGAGAATTCATCCTGAAACTCGAGTTTCAGGATGAATTCTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-1050s21c1
Sequence:CCGGCACTACAGGGATCATCGAATACTCGAGTATTCGATGATCCCTGTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008139.5-928s21c1
Sequence:CCGGTACGACAGACGACGGGAATATCTCGAGATATTCCCGTCGTCTGTCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002072
VALIDATED
GNAQ MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), q polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002072.2-841s1c1
Sequence:CCGGCCTCGGTTATTCTGTTCTTAACTCGAGTTAAGAACAGAATAACCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002072.2-456s1c1
Sequence:CCGGCCTGGAATCCAGGAATGCTATCTCGAGATAGCATTCCTGGATTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002072.2-369s1c1
Sequence:CCGGGCACAATTAGTTCGAGAAGTTCTCGAGAACTTCTCGAACTAATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002072.2-339s1c1
Sequence:CCGGCCATACAAGTATGAGCACAATCTCGAGATTGTGCTCATACTTGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002072.2-473s21c1
Sequence:CCGGCTATGATAGACGACGAGAATACTCGAGTATTCTCGTCGTCTATCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002072.2-1038s21c1
Sequence:CCGGGACACCGAGAATATCCGCTTTCTCGAGAAAGCGGATATTCTCGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002072.2-369s21c1
Sequence:CCGGGCACAATTAGTTCGAGAAGTTCTCGAGAACTTCTCGAACTAATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002072.2-841s21c1
Sequence:CCGGCCTCGGTTATTCTGTTCTTAACTCGAGTTAAGAACAGAATAACCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002072
VALIDATED
GNAQ MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), q polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002072.2-841s1c1
Sequence:CCGGCCTCGGTTATTCTGTTCTTAACTCGAGTTAAGAACAGAATAACCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002072.2-456s1c1
Sequence:CCGGCCTGGAATCCAGGAATGCTATCTCGAGATAGCATTCCTGGATTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002072.2-369s1c1
Sequence:CCGGGCACAATTAGTTCGAGAAGTTCTCGAGAACTTCTCGAACTAATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002072.2-339s1c1
Sequence:CCGGCCATACAAGTATGAGCACAATCTCGAGATTGTGCTCATACTTGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002072.2-473s21c1
Sequence:CCGGCTATGATAGACGACGAGAATACTCGAGTATTCTCGTCGTCTATCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002072.2-1038s21c1
Sequence:CCGGGACACCGAGAATATCCGCTTTCTCGAGAAAGCGGATATTCTCGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002072.2-369s21c1
Sequence:CCGGGCACAATTAGTTCGAGAAGTTCTCGAGAACTTCTCGAACTAATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002072.2-841s21c1
Sequence:CCGGCCTCGGTTATTCTGTTCTTAACTCGAGTTAAGAACAGAATAACCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002072
VALIDATED
GNAQ MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), q polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002072.2-841s1c1
Sequence:CCGGCCTCGGTTATTCTGTTCTTAACTCGAGTTAAGAACAGAATAACCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002072.2-456s1c1
Sequence:CCGGCCTGGAATCCAGGAATGCTATCTCGAGATAGCATTCCTGGATTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002072.2-369s1c1
Sequence:CCGGGCACAATTAGTTCGAGAAGTTCTCGAGAACTTCTCGAACTAATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002072.2-339s1c1
Sequence:CCGGCCATACAAGTATGAGCACAATCTCGAGATTGTGCTCATACTTGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002072.2-473s21c1
Sequence:CCGGCTATGATAGACGACGAGAATACTCGAGTATTCTCGTCGTCTATCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002072.2-1038s21c1
Sequence:CCGGGACACCGAGAATATCCGCTTTCTCGAGAAAGCGGATATTCTCGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002072.2-369s21c1
Sequence:CCGGGCACAATTAGTTCGAGAAGTTCTCGAGAACTTCTCGAACTAATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_002072.2-841s21c1
Sequence:CCGGCCTCGGTTATTCTGTTCTTAACTCGAGTTAAGAACAGAATAACCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)