EMAIL THIS PAGE TO A FRIEND

GNG4

guanine nucleotide binding protein (G protein), gamma 4

64 Gene Product Result for
UniProtKB ID: P50150
Gene ID:
Mouse(14706) guanine nucleotide binding protein (G protein), gamma 4
Rat(114118) guanine nucleotide binding protein (G protein), gamma 4
chicken(771582) guanine nucleotide binding protein (G protein), gamma 4
cow(100125276) guanine nucleotide binding protein (G protein), gamma 4
domestic cat(101081928) guanine nucleotide binding protein (G protein), gamma 4
dog(607513) guanine nucleotide binding protein (G protein), gamma 4
domestic guinea pig(100728440) guanine nucleotide binding protein (G protein), gamma 4
naked mole-rat(101696772) guanine nucleotide binding protein (G protein), gamma 4
sheep(101114927) guanine nucleotide binding protein (G protein), gamma 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0002786M1 Monoclonal Anti-GNG4 antibody produced in mouse clone 1D9-G11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004485 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010317 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010317 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010317 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051761 MISSION® esiRNA targeting human GNG4 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098721 Rosetta Predictions human pricing
NM_001098722 Rosetta Predictions human pricing
NM_004485 Rosetta Predictions human pricing
XM_001053747 Rosetta Predictions rat pricing
NM_010317 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098721 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319739 predicted 475 154.00
2 SASI_Hs02_00319740 predicted 1027 154.00
3 SASI_Hs02_00319741 predicted 941 154.00
4 SASI_Hs02_00319742 predicted 1008 154.00
5 SASI_Hs02_00319743 predicted 1004 154.00
6 SASI_Hs02_00319744 predicted 375 154.00
7 SASI_Hs02_00319745 predicted 475 154.00
8 SASI_Hs02_00319746 predicted 486 154.00
9 SASI_Hs02_00319747 predicted 989 154.00
10 SASI_Hs02_00319748 predicted 618 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319749 predicted 598 154.00
2 SASI_Hs02_00319750 predicted 1158 154.00
3 SASI_Hs02_00319751 predicted 1063 154.00
4 SASI_Hs02_00319752 predicted 1134 154.00
5 SASI_Hs02_00319753 predicted 1131 154.00
6 SASI_Hs02_00319754 predicted 500 154.00
7 SASI_Hs02_00319755 predicted 600 154.00
8 SASI_Hs02_00319756 predicted 609 154.00
9 SASI_Hs02_00319757 predicted 1106 154.00
10 SASI_Hs02_00319758 predicted 752 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337710 predicted 358 154.00
2 SASI_Hs02_00337711 predicted 921 154.00
3 SASI_Hs02_00337712 predicted 823 154.00
4 SASI_Hs02_00337713 predicted 902 154.00
5 SASI_Hs02_00337714 predicted 892 154.00
6 SASI_Hs01_00036289 predicted 266 154.00
7 SASI_Hs02_00337715 predicted 364 154.00
8 SASI_Hs02_00337716 predicted 372 154.00
9 SASI_Hs02_00337717 predicted 869 154.00
10 SASI_Hs02_00337718 predicted 509 154.00
11 SASI_Hs01_00036286 predicted 227 154.00
12 SASI_Hs01_00036287 predicted 340 154.00
13 SASI_Hs01_00036288 predicted 330 154.00
14 SASI_Hs01_00036290 predicted 308 154.00
15 SASI_Hs01_00036291 predicted 322 154.00
16 SASI_Hs01_00036292 predicted 357 154.00
17 SASI_Hs01_00036293 predicted 270 154.00
18 SASI_Hs01_00036294 predicted 285 154.00
19 SASI_Hs01_00036295 predicted 265 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273455 predicted 297 154.00
2 SASI_Rn02_00273456 predicted 628 154.00
3 SASI_Rn02_00273457 predicted 657 154.00
4 SASI_Rn02_00273458 predicted 404 154.00
5 SASI_Rn02_00273459 predicted 223 154.00
6 SASI_Rn02_00273460 predicted 256 154.00
7 SASI_Rn02_00273461 predicted 398 154.00
8 SASI_Rn02_00273462 predicted 402 154.00
9 SASI_Rn02_00273463 predicted 531 154.00
10 SASI_Rn02_00273464 predicted 358 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010317 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051967 predicted 906 154.00
2 SASI_Mm01_00051968 predicted 466 154.00
3 SASI_Mm01_00051969 predicted 931 154.00
4 SASI_Mm01_00051970 predicted 224 154.00
5 SASI_Mm01_00051971 predicted 766 154.00
6 SASI_Mm01_00051972 predicted 558 154.00
7 SASI_Mm01_00051973 predicted 441 154.00
8 SASI_Mm01_00051974 predicted 247 154.00
9 SASI_Mm01_00051975 predicted 796 154.00
10 SASI_Mm01_00051976 predicted 945 154.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004485
VALIDATED
GNG4 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004485.3-245s21c1
Sequence:CCGGCCACTAGCATCTCCCAAGCCACTCGAGTGGCTTGGGAGATGCTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004485.3-377s21c1
Sequence:CCGGTCATCATTCCAGTGCCTGCATCTCGAGATGCAGGCACTGGAATGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004485.3-282s21c1
Sequence:CCGGGCTAAAGATGGAAGCCTGTATCTCGAGATACAGGCTTCCATCTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004485.3-1543s21c1
Sequence:CCGGGCAGTAATATAAGGACCTGTTCTCGAGAACAGGTCCTTATATTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004485.3-364s21c1
Sequence:CCGGCGGGAAGATCCTCTCATCATTCTCGAGAATGATGAGAGGATCTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004485.2-1542s1c1
Sequence:CCGGGCAGTAATATAAGGACCTGTTCTCGAGAACAGGTCCTTATATTACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004485.2-282s1c1
Sequence:CCGGGCTAAAGATGGAAGCCTGTATCTCGAGATACAGGCTTCCATCTTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004485.2-377s1c1
Sequence:CCGGTCATCATTCCAGTGCCTGCATCTCGAGATGCAGGCACTGGAATGATGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004485.2-364s1c1
Sequence:CCGGCGGGAAGATCCTCTCATCATTCTCGAGAATGATGAGAGGATCTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004485.2-245s1c1
Sequence:CCGGCCACTAGCATCTCCCAAGCCACTCGAGTGGCTTGGGAGATGCTAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004485
VALIDATED
GNG4 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004485.3-245s21c1
Sequence:CCGGCCACTAGCATCTCCCAAGCCACTCGAGTGGCTTGGGAGATGCTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004485.3-377s21c1
Sequence:CCGGTCATCATTCCAGTGCCTGCATCTCGAGATGCAGGCACTGGAATGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004485.3-282s21c1
Sequence:CCGGGCTAAAGATGGAAGCCTGTATCTCGAGATACAGGCTTCCATCTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004485.3-1543s21c1
Sequence:CCGGGCAGTAATATAAGGACCTGTTCTCGAGAACAGGTCCTTATATTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004485.3-364s21c1
Sequence:CCGGCGGGAAGATCCTCTCATCATTCTCGAGAATGATGAGAGGATCTTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004485.2-1542s1c1
Sequence:CCGGGCAGTAATATAAGGACCTGTTCTCGAGAACAGGTCCTTATATTACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004485.2-282s1c1
Sequence:CCGGGCTAAAGATGGAAGCCTGTATCTCGAGATACAGGCTTCCATCTTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004485.2-377s1c1
Sequence:CCGGTCATCATTCCAGTGCCTGCATCTCGAGATGCAGGCACTGGAATGATGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004485.2-364s1c1
Sequence:CCGGCGGGAAGATCCTCTCATCATTCTCGAGAATGATGAGAGGATCTTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004485.2-245s1c1
Sequence:CCGGCCACTAGCATCTCCCAAGCCACTCGAGTGGCTTGGGAGATGCTAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004485
VALIDATED
GNG4 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004485.3-245s21c1
Sequence:CCGGCCACTAGCATCTCCCAAGCCACTCGAGTGGCTTGGGAGATGCTAGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000277952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004485.3-377s21c1
Sequence:CCGGTCATCATTCCAGTGCCTGCATCTCGAGATGCAGGCACTGGAATGATGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000277951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004485.3-282s21c1
Sequence:CCGGGCTAAAGATGGAAGCCTGTATCTCGAGATACAGGCTTCCATCTTTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000277950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004485.3-1543s21c1
Sequence:CCGGGCAGTAATATAAGGACCTGTTCTCGAGAACAGGTCCTTATATTACTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000278013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004485.3-364s21c1
Sequence:CCGGCGGGAAGATCCTCTCATCATTCTCGAGAATGATGAGAGGATCTTCCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004485.2-1542s1c1
Sequence:CCGGGCAGTAATATAAGGACCTGTTCTCGAGAACAGGTCCTTATATTACTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004485.2-282s1c1
Sequence:CCGGGCTAAAGATGGAAGCCTGTATCTCGAGATACAGGCTTCCATCTTTAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004485.2-377s1c1
Sequence:CCGGTCATCATTCCAGTGCCTGCATCTCGAGATGCAGGCACTGGAATGATGATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004485.2-364s1c1
Sequence:CCGGCGGGAAGATCCTCTCATCATTCTCGAGAATGATGAGAGGATCTTCCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000008808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004485.2-245s1c1
Sequence:CCGGCCACTAGCATCTCCCAAGCCACTCGAGTGGCTTGGGAGATGCTAGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010317
GNG4 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-343s1c1
Sequence:CCGGCCTGGCCTACTGTGAAGCCCACTCGAGTGGGCTTCACAGTAGGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-301s1c1
Sequence:CCGGCTGCATGGACAGGGTGAAGGTCTCGAGACCTTCACCCTGTCCATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-262s1c1
Sequence:CCGGCCAGGCCAGGAAAGCCGTGGACTCGAGTCCACGGCTTTCCTGGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-381s1c1
Sequence:CCGGTCATCATCCCAGTGCCTGCCTCTCGAGAGGCAGGCACTGGGATGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-254s1c1
Sequence:CCGGAGCATCTCCCAGGCCAGGAAACTCGAGTTTCCTGGCCTGGGAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010317
GNG4 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-343s1c1
Sequence:CCGGCCTGGCCTACTGTGAAGCCCACTCGAGTGGGCTTCACAGTAGGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-301s1c1
Sequence:CCGGCTGCATGGACAGGGTGAAGGTCTCGAGACCTTCACCCTGTCCATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-262s1c1
Sequence:CCGGCCAGGCCAGGAAAGCCGTGGACTCGAGTCCACGGCTTTCCTGGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-381s1c1
Sequence:CCGGTCATCATCCCAGTGCCTGCCTCTCGAGAGGCAGGCACTGGGATGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-254s1c1
Sequence:CCGGAGCATCTCCCAGGCCAGGAAACTCGAGTTTCCTGGCCTGGGAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010317
GNG4 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-343s1c1
Sequence:CCGGCCTGGCCTACTGTGAAGCCCACTCGAGTGGGCTTCACAGTAGGCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000037065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-301s1c1
Sequence:CCGGCTGCATGGACAGGGTGAAGGTCTCGAGACCTTCACCCTGTCCATGCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000037066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-262s1c1
Sequence:CCGGCCAGGCCAGGAAAGCCGTGGACTCGAGTCCACGGCTTTCCTGGCCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000037067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-381s1c1
Sequence:CCGGTCATCATCCCAGTGCCTGCCTCTCGAGAGGCAGGCACTGGGATGATGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000037068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010317.2-254s1c1
Sequence:CCGGAGCATCTCCCAGGCCAGGAAACTCGAGTTTCCTGGCCTGGGAGATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???