EMAIL THIS PAGE TO A FRIEND

GNG5

guanine nucleotide binding protein (G protein), gamma 5

51 Gene Product Result for
UniProtKB ID: P63218, B2R5A0, P30670, Q5VX54, Q61015
Gene ID:
Human(2787) Summary: G proteins are trimeric (alpha-beta-gamma) membrane-associated proteins that regulate flow of information from cell surface receptors to a variety of internal metabolic effectors. Interaction of a G protein with its activated receptor promotes exchange of GTP for GDP that is bound to the alpha subunit. The alpha-GTP complex dissociates from the beta-gamma heterodimer so that the subunits, in turn, may interact with and regulate effector molecules (Gilman, 1987 [PubMed 3113327]
Mouse(14707) guanine nucleotide binding protein (G protein), gamma 5
Rat(79218) guanine nucleotide binding protein (G protein), gamma 5
sheep(101110631) guanine nucleotide binding protein (G protein), gamma 5
naked mole-rat(101718403) guanine nucleotide binding protein (G protein), gamma 5
Zebrafish(337838) guanine nucleotide binding protein (G protein), gamma 5
cow(287018) guanine nucleotide binding protein (G protein), gamma 5
chicken(424538) guanine nucleotide binding protein (G protein), gamma 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010318 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010318 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010318 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005274 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005274 Rosetta Predictions human pricing
NM_024377 Rosetta Predictions rat pricing
NM_010318 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339321 predicted 501
2 SASI_Hs01_00194743 predicted 487
3 SASI_Hs02_00339322 predicted 502
4 SASI_Hs02_00339323 predicted 495
5 SASI_Hs02_00339324 predicted 563
6 SASI_Hs01_00194745 predicted 487
7 SASI_Hs02_00339325 predicted 562
8 SASI_Hs01_00194746 predicted 484
9 SASI_Hs01_00194747 predicted 492
10 SASI_Hs02_00339326 predicted 579
11 SASI_Hs01_00194744 predicted 472
12 SASI_Hs01_00194748 predicted 472
13 SASI_Hs01_00194749 predicted 475
14 SASI_Hs01_00194750 predicted 465
15 SASI_Hs01_00194751 predicted 462
16 SASI_Hs01_00194752 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024377 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108864 predicted 620
2 SASI_Rn02_00263968 predicted 339
3 SASI_Rn01_00108865 predicted 562
4 SASI_Rn01_00108867 predicted 293
5 SASI_Rn01_00108869 predicted 262
6 SASI_Rn01_00108870 predicted 380
7 SASI_Rn01_00108871 predicted 488
8 SASI_Rn01_00108873 predicted 348
9 SASI_Rn02_00263969 predicted 442
10 SASI_Rn02_00263970 predicted 610
11 SASI_Rn01_00108866 predicted 460
12 SASI_Rn01_00108868 predicted 575
13 SASI_Rn01_00108872 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084015 predicted 238
2 SASI_Mm01_00084016 predicted 248
3 SASI_Mm01_00084017 predicted 234
4 SASI_Mm01_00084018 predicted 244
5 SASI_Mm01_00084019 predicted 254
6 SASI_Mm01_00084020 predicted 212
7 SASI_Mm01_00084021 predicted 312
8 SASI_Mm01_00084022 predicted 234
9 SASI_Mm01_00084023 predicted 312
10 SASI_Mm01_00084024 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010318
VALIDATED
GNG5 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010318.1-206s1c1
Sequence:CCGGGTCTTCAAGTACGAATCCCTTCTCGAGAAGGGATTCGTACTTGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010318.1-200s1c1
Sequence:CCGGTGGAGTGTCTTCAAGTACGAACTCGAGTTCGTACTTGAAGACACTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010318.1-113s1c1
Sequence:CCGGCGGGCTCAACCGCGTGAAGGTCTCGAGACCTTCACGCGGTTGAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010318.1-145s1c1
Sequence:CCGGCTGCAGACTTGAAACAGTTCTCTCGAGAGAACTGTTTCAAGTCTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010318.1-190s1c1
Sequence:CCGGCTCTGCTGACTGGAGTGTCTTCTCGAGAAGACACTCCAGTCAGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010318
VALIDATED
GNG5 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010318.1-206s1c1
Sequence:CCGGGTCTTCAAGTACGAATCCCTTCTCGAGAAGGGATTCGTACTTGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010318.1-200s1c1
Sequence:CCGGTGGAGTGTCTTCAAGTACGAACTCGAGTTCGTACTTGAAGACACTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010318.1-113s1c1
Sequence:CCGGCGGGCTCAACCGCGTGAAGGTCTCGAGACCTTCACGCGGTTGAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010318.1-145s1c1
Sequence:CCGGCTGCAGACTTGAAACAGTTCTCTCGAGAGAACTGTTTCAAGTCTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010318.1-190s1c1
Sequence:CCGGCTCTGCTGACTGGAGTGTCTTCTCGAGAAGACACTCCAGTCAGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010318
VALIDATED
GNG5 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010318.1-206s1c1
Sequence:CCGGGTCTTCAAGTACGAATCCCTTCTCGAGAAGGGATTCGTACTTGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010318.1-200s1c1
Sequence:CCGGTGGAGTGTCTTCAAGTACGAACTCGAGTTCGTACTTGAAGACACTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010318.1-113s1c1
Sequence:CCGGCGGGCTCAACCGCGTGAAGGTCTCGAGACCTTCACGCGGTTGAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010318.1-145s1c1
Sequence:CCGGCTGCAGACTTGAAACAGTTCTCTCGAGAGAACTGTTTCAAGTCTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010318.1-190s1c1
Sequence:CCGGCTCTGCTGACTGGAGTGTCTTCTCGAGAAGACACTCCAGTCAGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005274
VALIDATED
GNG5 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-473s1c1
Sequence:CCGGCTCTGCTGACTGGAGTATCTTCTCGAGAAGATACTCCAGTCAGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-369s1c1
Sequence:CCGGAGTGGTTCAACAGCTCCGGCTCTCGAGAGCCGGAGCTGTTGAACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-491s1c1
Sequence:CCGGCTTCAAGTACAAATCCCTTCACTCGAGTGAAGGGATTTGTACTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-448s1c1
Sequence:CCGGTGTCTGCAGAATGCTCAACATCTCGAGATGTTGAGCATTCTGCAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-482s1c1
Sequence:CCGGCTGGAGTATCTTCAAGTACAACTCGAGTTGTACTTGAAGATACTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005274.2-480s21c1
Sequence:CCGGTGCTCAACATGACCCTCTGCTCTCGAGAGCAGAGGGTCATGTTGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005274.2-596s21c1
Sequence:CCGGCCTTATGATCCAGTGAATATTCTCGAGAATATTCACTGGATCATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005274.2-450s21c1
Sequence:CCGGTGCAGACTTGAAACAGTTCTGCTCGAGCAGAACTGTTTCAAGTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005274.2-503s21c1
Sequence:CCGGCTGGAGTATCTTCAAGTACAACTCGAGTTGTACTTGAAGATACTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005274
VALIDATED
GNG5 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-473s1c1
Sequence:CCGGCTCTGCTGACTGGAGTATCTTCTCGAGAAGATACTCCAGTCAGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-369s1c1
Sequence:CCGGAGTGGTTCAACAGCTCCGGCTCTCGAGAGCCGGAGCTGTTGAACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-491s1c1
Sequence:CCGGCTTCAAGTACAAATCCCTTCACTCGAGTGAAGGGATTTGTACTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-448s1c1
Sequence:CCGGTGTCTGCAGAATGCTCAACATCTCGAGATGTTGAGCATTCTGCAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-482s1c1
Sequence:CCGGCTGGAGTATCTTCAAGTACAACTCGAGTTGTACTTGAAGATACTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005274.2-480s21c1
Sequence:CCGGTGCTCAACATGACCCTCTGCTCTCGAGAGCAGAGGGTCATGTTGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005274.2-596s21c1
Sequence:CCGGCCTTATGATCCAGTGAATATTCTCGAGAATATTCACTGGATCATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005274.2-450s21c1
Sequence:CCGGTGCAGACTTGAAACAGTTCTGCTCGAGCAGAACTGTTTCAAGTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005274.2-503s21c1
Sequence:CCGGCTGGAGTATCTTCAAGTACAACTCGAGTTGTACTTGAAGATACTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005274
VALIDATED
GNG5 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-473s1c1
Sequence:CCGGCTCTGCTGACTGGAGTATCTTCTCGAGAAGATACTCCAGTCAGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-369s1c1
Sequence:CCGGAGTGGTTCAACAGCTCCGGCTCTCGAGAGCCGGAGCTGTTGAACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-491s1c1
Sequence:CCGGCTTCAAGTACAAATCCCTTCACTCGAGTGAAGGGATTTGTACTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-448s1c1
Sequence:CCGGTGTCTGCAGAATGCTCAACATCTCGAGATGTTGAGCATTCTGCAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005274.1-482s1c1
Sequence:CCGGCTGGAGTATCTTCAAGTACAACTCGAGTTGTACTTGAAGATACTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005274.2-480s21c1
Sequence:CCGGTGCTCAACATGACCCTCTGCTCTCGAGAGCAGAGGGTCATGTTGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005274.2-596s21c1
Sequence:CCGGCCTTATGATCCAGTGAATATTCTCGAGAATATTCACTGGATCATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005274.2-450s21c1
Sequence:CCGGTGCAGACTTGAAACAGTTCTGCTCGAGCAGAACTGTTTCAAGTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005274.2-503s21c1
Sequence:CCGGCTGGAGTATCTTCAAGTACAACTCGAGTTGTACTTGAAGATACTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)