EMAIL THIS PAGE TO A FRIEND

GNG7

guanine nucleotide binding protein (G protein), gamma 7

57 Gene Product Result for
UniProtKB ID: O60262, B2R496
Gene ID:
Mouse(14708) guanine nucleotide binding protein (G protein), gamma 7
Rat(58979) guanine nucleotide binding protein (G protein), gamma 7
Zebrafish(436670) guanine nucleotide binding protein (G protein), gamma 7
cow(618399) guanine nucleotide binding protein (G protein), gamma 7
domestic cat(101088219) guanine nucleotide binding protein (G protein), gamma 7
dog(612139) guanine nucleotide binding protein (G protein), gamma 7
domestic guinea pig(100731054) guanine nucleotide binding protein (G protein), gamma 7
naked mole-rat(101711281) guanine nucleotide binding protein (G protein), gamma 7
sheep(101120325) guanine nucleotide binding protein (G protein), gamma 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052847 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_005145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005145 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU089291 MISSION® esiRNA esiRNA targeting mouse Gng7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052847 Rosetta Predictions human pricing
NM_024138 Rosetta Predictions rat pricing
NM_001038655 Rosetta Predictions mouse pricing
NM_010319 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052587 predicted 850
2 SASI_Hs01_00052588 predicted 842
3 SASI_Hs01_00052589 predicted 775
4 SASI_Hs01_00052590 predicted 776
5 SASI_Hs01_00052591 predicted 831
6 SASI_Hs01_00052592 predicted 714
7 SASI_Hs01_00052593 predicted 824
8 SASI_Hs01_00052594 predicted 1028
9 SASI_Hs02_00361529 predicted 1010
10 SASI_Hs01_00052596 predicted 4024
11 SASI_Hs01_00052595 predicted 4124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061533 predicted 840
2 SASI_Rn01_00061534 predicted 729
3 SASI_Rn01_00061535 predicted 945
4 SASI_Rn01_00061536 predicted 288
5 SASI_Rn01_00061537 predicted 561
6 SASI_Rn01_00061539 predicted 348
7 SASI_Rn01_00061540 predicted 334
8 SASI_Rn01_00061541 predicted 860
9 SASI_Rn02_00263862 predicted 317
10 SASI_Rn02_00263863 predicted 299
11 SASI_Rn01_00061538 predicted 911
12 SASI_Rn01_00061542 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021994 predicted 794
2 SASI_Mm01_00021995 predicted 270
3 SASI_Mm01_00021996 predicted 827
4 SASI_Mm01_00021997 predicted 884
5 SASI_Mm01_00021998 predicted 383
6 SASI_Mm01_00021999 predicted 796
7 SASI_Mm01_00022000 predicted 719
8 SASI_Mm01_00022001 predicted 524
9 SASI_Mm01_00022002 predicted 518
10 SASI_Mm01_00022003 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124938 predicted 206
2 SASI_Mm01_00124939 predicted 757
3 SASI_Mm01_00124940 predicted 822
4 SASI_Mm01_00124941 predicted 317
5 SASI_Mm01_00124942 predicted 739
6 SASI_Mm01_00124943 predicted 659
7 SASI_Mm01_00124937 predicted 727
8 SASI_Mm01_00124944 predicted 462
9 SASI_Mm01_00124945 predicted 451
10 SASI_Mm01_00124946 predicted 676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010319
GNG7 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 7
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010319.3-277s21c1
Sequence:CCGGAGCAACATGCCCGCAACGATCCTCGAGGATCGTTGCGGGCATGTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010319.3-826s21c1
Sequence:CCGGGCCATTCTAGTTGTCAGTAAACTCGAGTTTACTGACAACTAGAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010319.3-417s21c1
Sequence:CCGGCCCGGAGGTATTGGTCCAATTCTCGAGAATTGGACCAATACCTCCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010319.3-218s21c1
Sequence:CCGGAGCTGGGATCGAACGCATCAACTCGAGTTGATGCGTTCGATCCCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010319.2-245s1c1
Sequence:CCGGGCCTCTGAGAATCCATTCAAACTCGAGTTTGAATGGATTCTCAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010319.2-137s1c1
Sequence:CCGGCGCATTGAAGCTGGGATCGAACTCGAGTTCGATCCCAGCTTCAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010319.2-154s1c1
Sequence:CCGGCGAACGCATCAAGGTCTCCAACTCGAGTTGGAGACCTTGATGCGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010319
GNG7 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 7
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010319.3-277s21c1
Sequence:CCGGAGCAACATGCCCGCAACGATCCTCGAGGATCGTTGCGGGCATGTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010319.3-826s21c1
Sequence:CCGGGCCATTCTAGTTGTCAGTAAACTCGAGTTTACTGACAACTAGAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010319.3-417s21c1
Sequence:CCGGCCCGGAGGTATTGGTCCAATTCTCGAGAATTGGACCAATACCTCCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010319.3-218s21c1
Sequence:CCGGAGCTGGGATCGAACGCATCAACTCGAGTTGATGCGTTCGATCCCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010319.2-245s1c1
Sequence:CCGGGCCTCTGAGAATCCATTCAAACTCGAGTTTGAATGGATTCTCAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010319.2-137s1c1
Sequence:CCGGCGCATTGAAGCTGGGATCGAACTCGAGTTCGATCCCAGCTTCAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010319.2-154s1c1
Sequence:CCGGCGAACGCATCAAGGTCTCCAACTCGAGTTGGAGACCTTGATGCGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010319
GNG7 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 7
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010319.3-277s21c1
Sequence:CCGGAGCAACATGCCCGCAACGATCCTCGAGGATCGTTGCGGGCATGTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010319.3-826s21c1
Sequence:CCGGGCCATTCTAGTTGTCAGTAAACTCGAGTTTACTGACAACTAGAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010319.3-417s21c1
Sequence:CCGGCCCGGAGGTATTGGTCCAATTCTCGAGAATTGGACCAATACCTCCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010319.3-218s21c1
Sequence:CCGGAGCTGGGATCGAACGCATCAACTCGAGTTGATGCGTTCGATCCCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010319.2-245s1c1
Sequence:CCGGGCCTCTGAGAATCCATTCAAACTCGAGTTTGAATGGATTCTCAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010319.2-137s1c1
Sequence:CCGGCGCATTGAAGCTGGGATCGAACTCGAGTTCGATCCCAGCTTCAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010319.2-154s1c1
Sequence:CCGGCGAACGCATCAAGGTCTCCAACTCGAGTTGGAGACCTTGATGCGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052847
GNG7 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-190s1c1
Sequence:CCGGGCTGGTGGAACAGCTACGCATCTCGAGATGCGTAGCTGTTCCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-241s1c1
Sequence:CCGGCAAAGCGGCGTCTGACCTCATCTCGAGATGAGGTCAGACGCCGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-223s1c1
Sequence:CCGGTGAGCGCATCAAGGTCTCCAACTCGAGTTGGAGACCTTGATGCGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-203s1c1
Sequence:CCGGCTACGCATAGAAGCCGGGATTCTCGAGAATCCCGGCTTCTATGCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-257s1c1
Sequence:CCGGCTCATGAGCTACTGTGAGCAACTCGAGTTGCTCACAGTAGCTCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052847
GNG7 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-190s1c1
Sequence:CCGGGCTGGTGGAACAGCTACGCATCTCGAGATGCGTAGCTGTTCCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-241s1c1
Sequence:CCGGCAAAGCGGCGTCTGACCTCATCTCGAGATGAGGTCAGACGCCGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-223s1c1
Sequence:CCGGTGAGCGCATCAAGGTCTCCAACTCGAGTTGGAGACCTTGATGCGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-203s1c1
Sequence:CCGGCTACGCATAGAAGCCGGGATTCTCGAGAATCCCGGCTTCTATGCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-257s1c1
Sequence:CCGGCTCATGAGCTACTGTGAGCAACTCGAGTTGCTCACAGTAGCTCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052847
GNG7 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-190s1c1
Sequence:CCGGGCTGGTGGAACAGCTACGCATCTCGAGATGCGTAGCTGTTCCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-241s1c1
Sequence:CCGGCAAAGCGGCGTCTGACCTCATCTCGAGATGAGGTCAGACGCCGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-223s1c1
Sequence:CCGGTGAGCGCATCAAGGTCTCCAACTCGAGTTGGAGACCTTGATGCGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-203s1c1
Sequence:CCGGCTACGCATAGAAGCCGGGATTCTCGAGAATCCCGGCTTCTATGCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052847.1-257s1c1
Sequence:CCGGCTCATGAGCTACTGTGAGCAACTCGAGTTGCTCACAGTAGCTCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005145
VALIDATED
GNG7 MISSION shRNA Bacterial Glycerol Stock
guanine nucleotide binding protein (G protein), gamma 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-356s1c1
Sequence:CCGGGCAGGGCATCATTCAGTAATTCTCGAGAATTACTGAATGATGCCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-118s1c1
Sequence:CCGGGTGGAACAGCTACGCATAGAACTCGAGTTCTATGCGTAGCTGTTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-250s1c1
Sequence:CCGGCCCTTTAAGGACAAGAAACCTCTCGAGAGGTTTCTTGTCCTTAAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-148s1c1
Sequence:CCGGGAGCGCATCAAGGTCTCCAAACTCGAGTTTGGAGACCTTGATGCGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-257s1c1
Sequence:CCGGAGGACAAGAAACCTTGTATTACTCGAGTAATACAAGGTTTCTTGTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005145
VALIDATED
GNG7 MISSION shRNA shRNA Plasmid DNA
guanine nucleotide binding protein (G protein), gamma 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-356s1c1
Sequence:CCGGGCAGGGCATCATTCAGTAATTCTCGAGAATTACTGAATGATGCCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-118s1c1
Sequence:CCGGGTGGAACAGCTACGCATAGAACTCGAGTTCTATGCGTAGCTGTTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-250s1c1
Sequence:CCGGCCCTTTAAGGACAAGAAACCTCTCGAGAGGTTTCTTGTCCTTAAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-148s1c1
Sequence:CCGGGAGCGCATCAAGGTCTCCAAACTCGAGTTTGGAGACCTTGATGCGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-257s1c1
Sequence:CCGGAGGACAAGAAACCTTGTATTACTCGAGTAATACAAGGTTTCTTGTCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005145
VALIDATED
GNG7 MISSION shRNA Lentiviral Transduction Particles
guanine nucleotide binding protein (G protein), gamma 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008809    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-356s1c1
Sequence:CCGGGCAGGGCATCATTCAGTAATTCTCGAGAATTACTGAATGATGCCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-118s1c1
Sequence:CCGGGTGGAACAGCTACGCATAGAACTCGAGTTCTATGCGTAGCTGTTCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-250s1c1
Sequence:CCGGCCCTTTAAGGACAAGAAACCTCTCGAGAGGTTTCTTGTCCTTAAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-148s1c1
Sequence:CCGGGAGCGCATCAAGGTCTCCAAACTCGAGTTTGGAGACCTTGATGCGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005145.1-257s1c1
Sequence:CCGGAGGACAAGAAACCTTGTATTACTCGAGTAATACAAGGTTTCTTGTCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)