EMAIL THIS PAGE TO A FRIEND

GNPTAB

N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits

79 Gene Product Result for
Synonyms: GNPTA ICD
Gene ID:
Human(79158) Summary: This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
Mouse(432486) N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Rat(362865) N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
domestic guinea pig(100716394) N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
naked mole-rat(101710539) N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
sheep(101122348) N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Domestic Rabbit(100340567) N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Zebrafish(553365) N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
dog(475443) N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
cow(509610) N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Horse(100067011) N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
domestic cat(101100231) N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
chicken(418096) N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2106865 Anti-GNPTAB antibody produced in rabbit affinity isolated antibody guinea pig, horse, human, rabbit
ELISA, western blot pricing
HPA017754 Anti-GNPTAB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024312 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024312 Rosetta Predictions human pricing
XM_001079967 Rosetta Predictions rat pricing
XM_343194 Rosetta Predictions rat pricing
NM_001004164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356653 predicted 3358
2 SASI_Hs01_00229378 predicted 3292
3 SASI_Hs02_00356654 predicted 3822
4 SASI_Hs01_00229380 predicted 3558
5 SASI_Hs01_00229381 predicted 3734
6 SASI_Hs01_00229382 predicted 4031
7 SASI_Hs01_00229383 predicted 732
8 SASI_Hs01_00229385 predicted 448
9 SASI_Hs01_00229386 predicted 3528
10 SASI_Hs01_00229387 predicted 1124
11 SASI_Hs01_00229379 predicted 3635
12 SASI_Hs01_00229384 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366104 predicted 1492
2 SASI_Rn02_00366105 predicted 3511
3 SASI_Rn02_00366106 predicted 1760
4 SASI_Rn02_00366107 predicted 1922
5 SASI_Rn02_00366108 predicted 987
6 SASI_Rn02_00366109 predicted 2786
7 SASI_Rn02_00366110 predicted 2979
8 SASI_Rn02_00366111 predicted 3028
9 SASI_Rn02_00366112 predicted 3242
10 SASI_Rn02_00366113 predicted 2314
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395473 predicted 1344
2 SASI_Rn02_00395474 predicted 3373
3 SASI_Rn02_00395475 predicted 1611
4 SASI_Rn02_00395476 predicted 1780
5 SASI_Rn02_00395477 predicted 844
6 SASI_Rn02_00395478 predicted 2645
7 SASI_Rn02_00395479 predicted 2834
8 SASI_Rn02_00395480 predicted 2881
9 SASI_Rn02_00395481 predicted 3097
10 SASI_Rn02_00395482 predicted 2171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122280 predicted 3376
2 SASI_Mm01_00122281 predicted 3491
3 SASI_Mm01_00122282 predicted 2177
4 SASI_Mm01_00122283 predicted 3582
5 SASI_Mm01_00122284 predicted 1573
6 SASI_Mm01_00122285 predicted 228
7 SASI_Mm01_00122286 predicted 385
8 SASI_Mm01_00122287 predicted 3535
9 SASI_Mm01_00122288 predicted 706
10 SASI_Mm01_00122289 predicted 2154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024312
VALIDATED
GNPTAB MISSION shRNA Bacterial Glycerol Stock
N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024312.3-4408s21c1
Sequence:CCGGATTCTTGCTTCTGAGTATAACCTCGAGGTTATACTCAGAAGCAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024312.3-3051s21c1
Sequence:CCGGCCTCACATGATTGACCGGATTCTCGAGAATCCGGTCAATCATGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024312.3-313s21c1
Sequence:CCGGGCCGAGATCAATACCATGTTTCTCGAGAAACATGGTATTGATCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024312.3-2822s21c1
Sequence:CCGGGCAGCATTACACAGATAGTTACTCGAGTAACTATCTGTGTAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024312.3-313s1c1
Sequence:CCGGGCCGAGATCAATACCATGTTTCTCGAGAAACATGGTATTGATCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024312.3-3051s1c1
Sequence:CCGGCCTCACATGATTGACCGGATTCTCGAGAATCCGGTCAATCATGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024312.3-3299s1c1
Sequence:CCGGGCCGTTAAGTTTGCAGGATTTCTCGAGAAATCCTGCAAACTTAACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024312.3-1375s1c1
Sequence:CCGGCCCAGAAGTTTATTTACCTAACTCGAGTTAGGTAAATAAACTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024312.3-2822s1c1
Sequence:CCGGGCAGCATTACACAGATAGTTACTCGAGTAACTATCTGTGTAATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024312
VALIDATED
GNPTAB MISSION shRNA shRNA Plasmid DNA
N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024312.3-4408s21c1
Sequence:CCGGATTCTTGCTTCTGAGTATAACCTCGAGGTTATACTCAGAAGCAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024312.3-3051s21c1
Sequence:CCGGCCTCACATGATTGACCGGATTCTCGAGAATCCGGTCAATCATGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024312.3-313s21c1
Sequence:CCGGGCCGAGATCAATACCATGTTTCTCGAGAAACATGGTATTGATCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024312.3-2822s21c1
Sequence:CCGGGCAGCATTACACAGATAGTTACTCGAGTAACTATCTGTGTAATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024312.3-313s1c1
Sequence:CCGGGCCGAGATCAATACCATGTTTCTCGAGAAACATGGTATTGATCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024312.3-3051s1c1
Sequence:CCGGCCTCACATGATTGACCGGATTCTCGAGAATCCGGTCAATCATGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024312.3-3299s1c1
Sequence:CCGGGCCGTTAAGTTTGCAGGATTTCTCGAGAAATCCTGCAAACTTAACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024312.3-1375s1c1
Sequence:CCGGCCCAGAAGTTTATTTACCTAACTCGAGTTAGGTAAATAAACTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024312.3-2822s1c1
Sequence:CCGGGCAGCATTACACAGATAGTTACTCGAGTAACTATCTGTGTAATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024312
VALIDATED
GNPTAB MISSION shRNA Lentiviral Transduction Particles
N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294077    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024312.3-4408s21c1
Sequence:CCGGATTCTTGCTTCTGAGTATAACCTCGAGGTTATACTCAGAAGCAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024312.3-3051s21c1
Sequence:CCGGCCTCACATGATTGACCGGATTCTCGAGAATCCGGTCAATCATGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024312.3-313s21c1
Sequence:CCGGGCCGAGATCAATACCATGTTTCTCGAGAAACATGGTATTGATCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_024312.3-2822s21c1
Sequence:CCGGGCAGCATTACACAGATAGTTACTCGAGTAACTATCTGTGTAATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024312.3-313s1c1
Sequence:CCGGGCCGAGATCAATACCATGTTTCTCGAGAAACATGGTATTGATCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024312.3-3051s1c1
Sequence:CCGGCCTCACATGATTGACCGGATTCTCGAGAATCCGGTCAATCATGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024312.3-3299s1c1
Sequence:CCGGGCCGTTAAGTTTGCAGGATTTCTCGAGAAATCCTGCAAACTTAACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024312.3-1375s1c1
Sequence:CCGGCCCAGAAGTTTATTTACCTAACTCGAGTTAGGTAAATAAACTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_024312.3-2822s1c1
Sequence:CCGGGCAGCATTACACAGATAGTTACTCGAGTAACTATCTGTGTAATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004164
VALIDATED
GNPTAB MISSION shRNA Bacterial Glycerol Stock
N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001004164.2-1025s21c1
Sequence:CCGGGCGCCATGGGTACGGAATATTCTCGAGAATATTCCGTACCCATGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004164.2-3243s21c1
Sequence:CCGGAGATCCACAAAGCCTATAAAGCTCGAGCTTTATAGGCTTTGTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001004164.2-4420s21c1
Sequence:CCGGGTGCTGCTCACCGGATGTAATCTCGAGATTACATCCGGTGAGCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004164.2-2821s1c1
Sequence:CCGGCATGATTGACAGGATCGTTATCTCGAGATAACGATCCTGTCAATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004164.2-1825s1c1
Sequence:CCGGGAACGCAACCACGATCTATTTCTCGAGAAATAGATCGTGGTTGCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001004164.2-1825s21c1
Sequence:CCGGGAACGCAACCACGATCTATTTCTCGAGAAATAGATCGTGGTTGCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001004164.2-3585s21c1
Sequence:CCGGGCGTACTAGCAACGTTGATTACTCGAGTAATCAACGTTGCTAGTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004164.1-743s1c1
Sequence:CCGGGCCTACTTGACAACAGACAAACTCGAGTTTGTCTGTTGTCAAGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004164
VALIDATED
GNPTAB MISSION shRNA shRNA Plasmid DNA
N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001004164.2-1025s21c1
Sequence:CCGGGCGCCATGGGTACGGAATATTCTCGAGAATATTCCGTACCCATGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004164.2-3243s21c1
Sequence:CCGGAGATCCACAAAGCCTATAAAGCTCGAGCTTTATAGGCTTTGTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001004164.2-4420s21c1
Sequence:CCGGGTGCTGCTCACCGGATGTAATCTCGAGATTACATCCGGTGAGCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004164.2-2821s1c1
Sequence:CCGGCATGATTGACAGGATCGTTATCTCGAGATAACGATCCTGTCAATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004164.2-1825s1c1
Sequence:CCGGGAACGCAACCACGATCTATTTCTCGAGAAATAGATCGTGGTTGCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001004164.2-1825s21c1
Sequence:CCGGGAACGCAACCACGATCTATTTCTCGAGAAATAGATCGTGGTTGCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001004164.2-3585s21c1
Sequence:CCGGGCGTACTAGCAACGTTGATTACTCGAGTAATCAACGTTGCTAGTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004164.1-743s1c1
Sequence:CCGGGCCTACTTGACAACAGACAAACTCGAGTTTGTCTGTTGTCAAGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004164
VALIDATED
GNPTAB MISSION shRNA Lentiviral Transduction Particles
N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001004164.2-1025s21c1
Sequence:CCGGGCGCCATGGGTACGGAATATTCTCGAGAATATTCCGTACCCATGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004164.2-3243s21c1
Sequence:CCGGAGATCCACAAAGCCTATAAAGCTCGAGCTTTATAGGCTTTGTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243580    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001004164.2-4420s21c1
Sequence:CCGGGTGCTGCTCACCGGATGTAATCTCGAGATTACATCCGGTGAGCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004164.2-2821s1c1
Sequence:CCGGCATGATTGACAGGATCGTTATCTCGAGATAACGATCCTGTCAATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217630    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004164.2-1825s1c1
Sequence:CCGGGAACGCAACCACGATCTATTTCTCGAGAAATAGATCGTGGTTGCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001004164.2-1825s21c1
Sequence:CCGGGAACGCAACCACGATCTATTTCTCGAGAAATAGATCGTGGTTGCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001004164.2-3585s21c1
Sequence:CCGGGCGTACTAGCAACGTTGATTACTCGAGTAATCAACGTTGCTAGTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004164.1-743s1c1
Sequence:CCGGGCCTACTTGACAACAGACAAACTCGAGTTTGTCTGTTGTCAAGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)