EMAIL THIS PAGE TO A FRIEND

GNS

glucosamine (N-acetyl)-6-sulfatase

101 Gene Product Result for
Synonyms: G6S
UniProtKB ID: P15586, Q53F05
Gene ID:
Human(2799) Summary: The product of this gene is a lysosomal enzyme found in all cells. It is involved in the catabolism of heparin, heparan sulphate, and keratan sulphate. Deficiency of this enzyme results in the accumulation of undegraded substrate and the lysosomal storage disorder mucopolysaccharidosis type IIID (Sanfilippo D syndrome). Mucopolysaccharidosis type IIID is the least common of the four subtypes of Sanfilippo syndrome. [provided by RefSeq, Jul 2008]
Mouse(75612) glucosamine (N-acetyl)-6-sulfatase
Rat(299825) glucosamine (N-acetyl)-6-sulfatase
chicken(417829) glucosamine (N-acetyl)-6-sulfatase
dog(474429) glucosamine (N-acetyl)-6-sulfatase
domestic cat(101088174) glucosamine (N-acetyl)-6-sulfatase
cow(512444) glucosamine (N-acetyl)-6-sulfatase
Goat(100750233) glucosamine (N-acetyl)-6-sulfatase
sheep(101110316) glucosamine (N-acetyl)-6-sulfatase
Domestic Rabbit(100359029) glucosamine (N-acetyl)-6-sulfatase
domestic guinea pig(100713038) glucosamine (N-acetyl)-6-sulfatase
naked mole-rat(101710393) glucosamine (N-acetyl)-6-sulfatase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029364 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029364 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029364 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002076 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002076 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002076 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002076 Rosetta Predictions human pricing
NM_001011989 Rosetta Predictions rat pricing
XM_001081063 Rosetta Predictions rat pricing
XM_576231 Rosetta Predictions rat pricing
NM_029364 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002076 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208343 predicted 559
2 SASI_Hs01_00208344 predicted 1261
3 SASI_Hs01_00208345 predicted 891
4 SASI_Hs01_00208346 predicted 790
5 SASI_Hs02_00333150 predicted 995
6 SASI_Hs01_00208348 predicted 1582
7 SASI_Hs01_00208349 predicted 1625
8 SASI_Hs01_00208350 predicted 1334
9 SASI_Hs01_00208351 predicted 1877
10 SASI_Hs01_00208352 predicted 1867
11 SASI_Hs01_00208347 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051697 predicted 777
2 SASI_Rn01_00051698 predicted 1412
3 SASI_Rn01_00051699 predicted 909
4 SASI_Rn01_00051700 predicted 717
5 SASI_Rn01_00051701 predicted 1451
6 SASI_Rn01_00051702 predicted 224
7 SASI_Rn01_00051703 predicted 301
8 SASI_Rn01_00051704 predicted 1419
9 SASI_Rn01_00051705 predicted 1448
10 SASI_Rn01_00051706 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081063 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370414 predicted 1192
2 SASI_Rn02_00370415 predicted 1494
3 SASI_Rn02_00370416 predicted 1317
4 SASI_Rn02_00370417 predicted 1127
5 SASI_Rn02_00370418 predicted 642
6 SASI_Rn02_00370419 predicted 709
7 SASI_Rn02_00370420 predicted 1430
8 SASI_Rn02_00370421 predicted 1168
9 SASI_Rn02_00370422 predicted 1202
10 SASI_Rn02_00370423 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180554 predicted 845
2 SASI_Rn01_00180555 predicted 802
3 SASI_Rn01_00180556 predicted 970
4 SASI_Rn01_00180557 predicted 774
5 SASI_Rn01_00180558 predicted 285
6 SASI_Rn01_00180559 predicted 368
7 SASI_Rn01_00180560 predicted 1006
8 SASI_Rn01_00180561 predicted 719
9 SASI_Rn01_00180562 predicted 1079
10 SASI_Rn01_00180563 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033776 predicted 1279
2 SASI_Mm01_00033778 predicted 1484
3 SASI_Mm01_00033779 predicted 1698
4 SASI_Mm01_00033780 predicted 1029
5 SASI_Mm01_00033781 predicted 1641
6 SASI_Mm01_00033782 predicted 1269
7 SASI_Mm01_00033783 predicted 429
8 SASI_Mm02_00335231 predicted 746
9 SASI_Mm01_00033784 predicted 1407
10 SASI_Mm01_00033785 predicted 1670
11 SASI_Mm01_00033777 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029364
VALIDATED
GNS MISSION shRNA Bacterial Glycerol Stock
glucosamine (N-acetyl)-6-sulfatase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029364.1-904s1c1
Sequence:CCGGCCCATGACGAACTCGTCAATACTCGAGTATTGACGAGTTCGTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029364.1-399s1c1
Sequence:CCGGCCACGTCGTTAACAACACTTTCTCGAGAAAGTGTTGTTAACGACGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029364.1-1099s1c1
Sequence:CCGGCGGCAGCTGTATGAGTTTGATCTCGAGATCAAACTCATACAGCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029364.1-1531s1c1
Sequence:CCGGCCAGACCAGATCACCAACATTCTCGAGAATGTTGGTGATCTGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029364.1-1179s1c1
Sequence:CCGGGCTGGTCTCAAACATCGACTTCTCGAGAAGTCGATGTTTGAGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029364
VALIDATED
GNS MISSION shRNA shRNA Plasmid DNA
glucosamine (N-acetyl)-6-sulfatase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029364.1-904s1c1
Sequence:CCGGCCCATGACGAACTCGTCAATACTCGAGTATTGACGAGTTCGTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029364.1-399s1c1
Sequence:CCGGCCACGTCGTTAACAACACTTTCTCGAGAAAGTGTTGTTAACGACGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029364.1-1099s1c1
Sequence:CCGGCGGCAGCTGTATGAGTTTGATCTCGAGATCAAACTCATACAGCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029364.1-1531s1c1
Sequence:CCGGCCAGACCAGATCACCAACATTCTCGAGAATGTTGGTGATCTGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029364.1-1179s1c1
Sequence:CCGGGCTGGTCTCAAACATCGACTTCTCGAGAAGTCGATGTTTGAGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029364
VALIDATED
GNS MISSION shRNA Lentiviral Transduction Particles
glucosamine (N-acetyl)-6-sulfatase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029364.1-904s1c1
Sequence:CCGGCCCATGACGAACTCGTCAATACTCGAGTATTGACGAGTTCGTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029364.1-399s1c1
Sequence:CCGGCCACGTCGTTAACAACACTTTCTCGAGAAAGTGTTGTTAACGACGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029364.1-1099s1c1
Sequence:CCGGCGGCAGCTGTATGAGTTTGATCTCGAGATCAAACTCATACAGCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029364.1-1531s1c1
Sequence:CCGGCCAGACCAGATCACCAACATTCTCGAGAATGTTGGTGATCTGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029364.1-1179s1c1
Sequence:CCGGGCTGGTCTCAAACATCGACTTCTCGAGAAGTCGATGTTTGAGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002076
VALIDATED
GNS MISSION shRNA Bacterial Glycerol Stock
glucosamine (N-acetyl)-6-sulfatase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002076.2-1308s1c1
Sequence:CCGGCGACCTAAATAAGACACAGATCTCGAGATCTGTGTCTTATTTAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002076.2-1182s1c1
Sequence:CCGGGCTGTATGAGTTTGATATCAACTCGAGTTGATATCAAACTCATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_002076.2-541s1c1
Sequence:CCGGCCAAATACTTTCCCAGCAATTCTCGAGAATTGCTGGGAAAGTATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002076.2-1608s1c1
Sequence:CCGGCCCAGACCAGATCACTAACATCTCGAGATGTTAGTGATCTGGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002076.2-552s1c1
Sequence:CCGGCCCAGCAATTCTCAGATCAATCTCGAGATTGATCTGAGAATTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-566s21c1
Sequence:CCGGCCCAGCAATTCTCAGATCAATCTCGAGATTGATCTGAGAATTGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-2167s21c1
Sequence:CCGGCAGATAAATGGCAGTACTTTACTCGAGTAAAGTACTGCCATTTATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-1622s21c1
Sequence:CCGGCCCAGACCAGATCACTAACATCTCGAGATGTTAGTGATCTGGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-1791s21c1
Sequence:CCGGAGTGTCAGGACTCGAAGATTTCTCGAGAAATCTTCGAGTCCTGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-555s21c1
Sequence:CCGGCCAAATACTTTCCCAGCAATTCTCGAGAATTGCTGGGAAAGTATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002076
VALIDATED
GNS MISSION shRNA shRNA Plasmid DNA
glucosamine (N-acetyl)-6-sulfatase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002076.2-1308s1c1
Sequence:CCGGCGACCTAAATAAGACACAGATCTCGAGATCTGTGTCTTATTTAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002076.2-1182s1c1
Sequence:CCGGGCTGTATGAGTTTGATATCAACTCGAGTTGATATCAAACTCATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_002076.2-541s1c1
Sequence:CCGGCCAAATACTTTCCCAGCAATTCTCGAGAATTGCTGGGAAAGTATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002076.2-1608s1c1
Sequence:CCGGCCCAGACCAGATCACTAACATCTCGAGATGTTAGTGATCTGGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002076.2-552s1c1
Sequence:CCGGCCCAGCAATTCTCAGATCAATCTCGAGATTGATCTGAGAATTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-566s21c1
Sequence:CCGGCCCAGCAATTCTCAGATCAATCTCGAGATTGATCTGAGAATTGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-2167s21c1
Sequence:CCGGCAGATAAATGGCAGTACTTTACTCGAGTAAAGTACTGCCATTTATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-1622s21c1
Sequence:CCGGCCCAGACCAGATCACTAACATCTCGAGATGTTAGTGATCTGGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-1791s21c1
Sequence:CCGGAGTGTCAGGACTCGAAGATTTCTCGAGAAATCTTCGAGTCCTGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-555s21c1
Sequence:CCGGCCAAATACTTTCCCAGCAATTCTCGAGAATTGCTGGGAAAGTATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002076
VALIDATED
GNS MISSION shRNA Lentiviral Transduction Particles
glucosamine (N-acetyl)-6-sulfatase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002076.2-1308s1c1
Sequence:CCGGCGACCTAAATAAGACACAGATCTCGAGATCTGTGTCTTATTTAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002076.2-1182s1c1
Sequence:CCGGGCTGTATGAGTTTGATATCAACTCGAGTTGATATCAAACTCATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_002076.2-541s1c1
Sequence:CCGGCCAAATACTTTCCCAGCAATTCTCGAGAATTGCTGGGAAAGTATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002076.2-1608s1c1
Sequence:CCGGCCCAGACCAGATCACTAACATCTCGAGATGTTAGTGATCTGGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002076.2-552s1c1
Sequence:CCGGCCCAGCAATTCTCAGATCAATCTCGAGATTGATCTGAGAATTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-566s21c1
Sequence:CCGGCCCAGCAATTCTCAGATCAATCTCGAGATTGATCTGAGAATTGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-2167s21c1
Sequence:CCGGCAGATAAATGGCAGTACTTTACTCGAGTAAAGTACTGCCATTTATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-1622s21c1
Sequence:CCGGCCCAGACCAGATCACTAACATCTCGAGATGTTAGTGATCTGGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-1791s21c1
Sequence:CCGGAGTGTCAGGACTCGAAGATTTCTCGAGAAATCTTCGAGTCCTGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002076.3-555s21c1
Sequence:CCGGCCAAATACTTTCCCAGCAATTCTCGAGAATTGCTGGGAAAGTATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)