EMAIL THIS PAGE TO A FRIEND

GOLGA1

golgin A1

135 Gene Product Result for
Synonyms: golgin-97
UniProtKB ID: Q92805, Q5T164, Q8IYZ9
Gene ID:
Human(2800) Summary: The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein is associated with Sjogren's syndrome. [provided by RefSeq, Feb 2010]
Mouse(76899) golgi autoantigen, golgin subfamily a, 1
Rat(311919) golgin A1
sheep(101107341) golgin A1
Zebrafish(393811) golgin A1
cow(511191) golgin A1
Horse(100067264) golgin A1
dog(480728) golgin A1
chicken(417097) golgin A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002077 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002077 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002077 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002077 Rosetta Predictions human pricing
NM_001107842 Rosetta Predictions rat pricing
NM_029793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149334 predicted 2695
2 SASI_Hs01_00149335 predicted 2385
3 SASI_Hs01_00149336 predicted 1037
4 SASI_Hs02_00333151 predicted 396
5 SASI_Hs01_00149337 predicted 523
6 SASI_Hs01_00149338 predicted 964
7 SASI_Hs01_00149339 predicted 1183
8 SASI_Hs01_00149340 predicted 2512
9 SASI_Hs01_00149341 predicted 2352
10 SASI_Hs01_00149342 predicted 2392
11 SASI_Hs01_00149343 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232815 predicted 2340
2 SASI_Rn02_00232816 predicted 1444
3 SASI_Rn02_00232817 predicted 590
4 SASI_Rn02_00232818 predicted 2135
5 SASI_Rn02_00232819 predicted 481
6 SASI_Rn02_00232820 predicted 950
7 SASI_Rn02_00232821 predicted 1651
8 SASI_Rn02_00232822 predicted 789
9 SASI_Rn02_00232823 predicted 555
10 SASI_Rn02_00232824 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083175 predicted 2244
2 SASI_Mm01_00083176 predicted 1302
3 SASI_Mm01_00083177 predicted 496
4 SASI_Mm01_00083178 predicted 1559
5 SASI_Mm01_00083179 predicted 1625
6 SASI_Mm01_00083180 predicted 2107
7 SASI_Mm01_00083181 predicted 1510
8 SASI_Mm02_00335937 predicted 1963
9 SASI_Mm01_00083182 predicted 418
10 SASI_Mm01_00083183 predicted 2048
11 SASI_Mm01_00083184 predicted 2557
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002077
VALIDATED
GOLGA1 MISSION shRNA Bacterial Glycerol Stock
golgin A1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002077.3-2543s21c1
Sequence:CCGGTCAAGGAAACTCTGGAATATACTCGAGTATATTCCAGAGTTTCCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002077.3-2861s21c1
Sequence:CCGGGTCCTGGCACTACCCAGATTTCTCGAGAAATCTGGGTAGTGCCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002077.3-2732s21c1
Sequence:CCGGATCACTGTAACTGCAGTATTTCTCGAGAAATACTGCAGTTACAGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002077.3-640s21c1
Sequence:CCGGGATTCTTCCATGCGGAAATTTCTCGAGAAATTTCCGCATGGAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002077.3-951s21c1
Sequence:CCGGGGCACGAACCAGAGAACTTAGCTCGAGCTAAGTTCTCTGGTTCGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002077.3-2757s21c1
Sequence:CCGGCAAGTGTCTAAACATTGTTTACTCGAGTAAACAATGTTTAGACACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002077.2-4181s1c1
Sequence:CCGGGCAGACAGTTATCCCTTGTTTCTCGAGAAACAAGGGATAACTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002077.2-635s1c1
Sequence:CCGGGAGCAGAATGAGACATTCCAACTCGAGTTGGAATGTCTCATTCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130101    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002077.2-3445s1c1
Sequence:CCGGCCAGAGGAAATTCTTCCTAAACTCGAGTTTAGGAAGAATTTCCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002077.2-1225s1c1
Sequence:CCGGGAAGAGACTAGAACAGAACTTCTCGAGAAGTTCTGTTCTAGTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002077.2-1826s1c1
Sequence:CCGGGCCATAATAGACGAGAAGGAACTCGAGTTCCTTCTCGTCTATTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002077.2-2387s1c1
Sequence:CCGGGAGATCAACTTTGAGTACCTTCTCGAGAAGGTACTCAAAGTTGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002077.2-806s1c1
Sequence:CCGGCAAAGGAGAGATGAAATGGATCTCGAGATCCATTTCATCTCTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002077
VALIDATED
GOLGA1 MISSION shRNA shRNA Plasmid DNA
golgin A1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002077.3-2543s21c1
Sequence:CCGGTCAAGGAAACTCTGGAATATACTCGAGTATATTCCAGAGTTTCCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002077.3-2861s21c1
Sequence:CCGGGTCCTGGCACTACCCAGATTTCTCGAGAAATCTGGGTAGTGCCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002077.3-2732s21c1
Sequence:CCGGATCACTGTAACTGCAGTATTTCTCGAGAAATACTGCAGTTACAGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002077.3-640s21c1
Sequence:CCGGGATTCTTCCATGCGGAAATTTCTCGAGAAATTTCCGCATGGAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002077.3-951s21c1
Sequence:CCGGGGCACGAACCAGAGAACTTAGCTCGAGCTAAGTTCTCTGGTTCGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002077.3-2757s21c1
Sequence:CCGGCAAGTGTCTAAACATTGTTTACTCGAGTAAACAATGTTTAGACACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002077.2-4181s1c1
Sequence:CCGGGCAGACAGTTATCCCTTGTTTCTCGAGAAACAAGGGATAACTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002077.2-635s1c1
Sequence:CCGGGAGCAGAATGAGACATTCCAACTCGAGTTGGAATGTCTCATTCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130101    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002077.2-3445s1c1
Sequence:CCGGCCAGAGGAAATTCTTCCTAAACTCGAGTTTAGGAAGAATTTCCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002077.2-1225s1c1
Sequence:CCGGGAAGAGACTAGAACAGAACTTCTCGAGAAGTTCTGTTCTAGTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002077.2-1826s1c1
Sequence:CCGGGCCATAATAGACGAGAAGGAACTCGAGTTCCTTCTCGTCTATTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002077.2-2387s1c1
Sequence:CCGGGAGATCAACTTTGAGTACCTTCTCGAGAAGGTACTCAAAGTTGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002077.2-806s1c1
Sequence:CCGGCAAAGGAGAGATGAAATGGATCTCGAGATCCATTTCATCTCTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002077
VALIDATED
GOLGA1 MISSION shRNA Lentiviral Transduction Particles
golgin A1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002077.3-2543s21c1
Sequence:CCGGTCAAGGAAACTCTGGAATATACTCGAGTATATTCCAGAGTTTCCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002077.3-2861s21c1
Sequence:CCGGGTCCTGGCACTACCCAGATTTCTCGAGAAATCTGGGTAGTGCCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002077.3-2732s21c1
Sequence:CCGGATCACTGTAACTGCAGTATTTCTCGAGAAATACTGCAGTTACAGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002077.3-640s21c1
Sequence:CCGGGATTCTTCCATGCGGAAATTTCTCGAGAAATTTCCGCATGGAAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002077.3-951s21c1
Sequence:CCGGGGCACGAACCAGAGAACTTAGCTCGAGCTAAGTTCTCTGGTTCGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002077.3-2757s21c1
Sequence:CCGGCAAGTGTCTAAACATTGTTTACTCGAGTAAACAATGTTTAGACACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130875    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002077.2-4181s1c1
Sequence:CCGGGCAGACAGTTATCCCTTGTTTCTCGAGAAACAAGGGATAACTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002077.2-635s1c1
Sequence:CCGGGAGCAGAATGAGACATTCCAACTCGAGTTGGAATGTCTCATTCTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130101    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002077.2-3445s1c1
Sequence:CCGGCCAGAGGAAATTCTTCCTAAACTCGAGTTTAGGAAGAATTTCCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002077.2-1225s1c1
Sequence:CCGGGAAGAGACTAGAACAGAACTTCTCGAGAAGTTCTGTTCTAGTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149266    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002077.2-1826s1c1
Sequence:CCGGGCCATAATAGACGAGAAGGAACTCGAGTTCCTTCTCGTCTATTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002077.2-2387s1c1
Sequence:CCGGGAGATCAACTTTGAGTACCTTCTCGAGAAGGTACTCAAAGTTGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002077.2-806s1c1
Sequence:CCGGCAAAGGAGAGATGAAATGGATCTCGAGATCCATTTCATCTCTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029793
VALIDATED
GOLGA1 MISSION shRNA Bacterial Glycerol Stock
golgin A1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-1086s1c1
Sequence:CCGGCATCTACAAGAGAAGGTTATACTCGAGTATAACCTTCTCTTGTAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-2049s1c1
Sequence:CCGGGACTTAGAACAGCAACTTATCCTCGAGGATAAGTTGCTGTTCTAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-501s1c1
Sequence:CCGGGATTCTTCCATGCGGAAATTTCTCGAGAAATTTCCGCATGGAAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-2244s1c1
Sequence:CCGGGCCCGAGAGATCAACTTTGAACTCGAGTTCAAAGTTGATCTCTCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029793.1-2938s1c1
Sequence:CCGGCCTCTCAAGAAAGTATCATTACTCGAGTAATGATACTTTCTTGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029793.1-1452s1c1
Sequence:CCGGGCCCAAATTGAAGCTCTGGAACTCGAGTTCCAGAGCTTCAATTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-2342s1c1
Sequence:CCGGGCTGCTGAATTTCTCACAAGACTCGAGTCTTGTGAGAAATTCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029793.1-2386s1c1
Sequence:CCGGCTCTGGAATATAAGATGTCTTCTCGAGAAGACATCTTATATTCCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029793.1-1125s1c1
Sequence:CCGGGAACAGAATTTATCAGGAGAACTCGAGTTCTCCTGATAAATTCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029793
VALIDATED
GOLGA1 MISSION shRNA shRNA Plasmid DNA
golgin A1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-1086s1c1
Sequence:CCGGCATCTACAAGAGAAGGTTATACTCGAGTATAACCTTCTCTTGTAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-2049s1c1
Sequence:CCGGGACTTAGAACAGCAACTTATCCTCGAGGATAAGTTGCTGTTCTAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-501s1c1
Sequence:CCGGGATTCTTCCATGCGGAAATTTCTCGAGAAATTTCCGCATGGAAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-2244s1c1
Sequence:CCGGGCCCGAGAGATCAACTTTGAACTCGAGTTCAAAGTTGATCTCTCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029793.1-2938s1c1
Sequence:CCGGCCTCTCAAGAAAGTATCATTACTCGAGTAATGATACTTTCTTGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029793.1-1452s1c1
Sequence:CCGGGCCCAAATTGAAGCTCTGGAACTCGAGTTCCAGAGCTTCAATTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-2342s1c1
Sequence:CCGGGCTGCTGAATTTCTCACAAGACTCGAGTCTTGTGAGAAATTCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029793.1-2386s1c1
Sequence:CCGGCTCTGGAATATAAGATGTCTTCTCGAGAAGACATCTTATATTCCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029793.1-1125s1c1
Sequence:CCGGGAACAGAATTTATCAGGAGAACTCGAGTTCTCCTGATAAATTCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029793
VALIDATED
GOLGA1 MISSION shRNA Lentiviral Transduction Particles
golgin A1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-1086s1c1
Sequence:CCGGCATCTACAAGAGAAGGTTATACTCGAGTATAACCTTCTCTTGTAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-2049s1c1
Sequence:CCGGGACTTAGAACAGCAACTTATCCTCGAGGATAAGTTGCTGTTCTAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-501s1c1
Sequence:CCGGGATTCTTCCATGCGGAAATTTCTCGAGAAATTTCCGCATGGAAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-2244s1c1
Sequence:CCGGGCCCGAGAGATCAACTTTGAACTCGAGTTCAAAGTTGATCTCTCGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191211    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029793.1-2938s1c1
Sequence:CCGGCCTCTCAAGAAAGTATCATTACTCGAGTAATGATACTTTCTTGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029793.1-1452s1c1
Sequence:CCGGGCCCAAATTGAAGCTCTGGAACTCGAGTTCCAGAGCTTCAATTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029793.1-2342s1c1
Sequence:CCGGGCTGCTGAATTTCTCACAAGACTCGAGTCTTGTGAGAAATTCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029793.1-2386s1c1
Sequence:CCGGCTCTGGAATATAAGATGTCTTCTCGAGAAGACATCTTATATTCCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029793.1-1125s1c1
Sequence:CCGGGAACAGAATTTATCAGGAGAACTCGAGTTCTCCTGATAAATTCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)