EMAIL THIS PAGE TO A FRIEND

GOLGA6A

golgin A6 family, member A

60 Gene Product Result for
Synonyms: GLP GOLGA6
Species: Human GOLGA6A(342096)
UniProtKB ID: Q9NYA3, A8K959, Q9NYA7
Gene ID:
Human(342096) Summary: The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. The protein encoded by this gene is a member of the golgin family of proteins, whose members localize to the Golgi. This gene is found in a large, low copy repeat sequence or duplicon that is found in multiple copies, that are greather than 90% similar, on chromosome 15. Duplicons are associated with deletions, inversions and other chromosome rearrangements that underlie genomic disease. The protein encoded by this gene is thought to be a functional golgin protein while the majority of the related copies of this gene are thought to be transcribed pseudogenes. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001038640 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001038640 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001038640 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001038640 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166017 predicted 82
2 SASI_Hs01_00166014 predicted 526
3 SASI_Hs01_00166016 predicted 519
4 SASI_Hs01_00166013 predicted 403
5 SASI_Hs01_00166015 predicted 537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001038640
GOLGA6A MISSION shRNA Bacterial Glycerol Stock
golgin A6 family, member A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038640.2-456s21c1
Sequence:CCGGACCACCCTTTACCATACTAAACTCGAGTTTAGTATGGTAAAGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038640.2-639s21c1
Sequence:CCGGTGGTTACAGCAGACCATAAAGCTCGAGCTTTATGGTCTGCTGTAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038640.2-1738s21c1
Sequence:CCGGGAGAGTCCTTCACCGTATATGCTCGAGCATATACGGTGAAGGACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001038640.2-2482s21c1
Sequence:CCGGCACACAAAGACCCACTAATTTCTCGAGAAATTAGTGGGTCTTTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038640.2-718s21c1
Sequence:CCGGAGCTAGAGCGAGACGAATATGCTCGAGCATATTCGTCTCGCTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001038640
GOLGA6A MISSION shRNA shRNA Plasmid DNA
golgin A6 family, member A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038640.2-456s21c1
Sequence:CCGGACCACCCTTTACCATACTAAACTCGAGTTTAGTATGGTAAAGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038640.2-639s21c1
Sequence:CCGGTGGTTACAGCAGACCATAAAGCTCGAGCTTTATGGTCTGCTGTAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038640.2-1738s21c1
Sequence:CCGGGAGAGTCCTTCACCGTATATGCTCGAGCATATACGGTGAAGGACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001038640.2-2482s21c1
Sequence:CCGGCACACAAAGACCCACTAATTTCTCGAGAAATTAGTGGGTCTTTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038640.2-718s21c1
Sequence:CCGGAGCTAGAGCGAGACGAATATGCTCGAGCATATTCGTCTCGCTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001038640
GOLGA6A MISSION shRNA Lentiviral Transduction Particles
golgin A6 family, member A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038640.2-456s21c1
Sequence:CCGGACCACCCTTTACCATACTAAACTCGAGTTTAGTATGGTAAAGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038640.2-639s21c1
Sequence:CCGGTGGTTACAGCAGACCATAAAGCTCGAGCTTTATGGTCTGCTGTAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038640.2-1738s21c1
Sequence:CCGGGAGAGTCCTTCACCGTATATGCTCGAGCATATACGGTGAAGGACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001038640.2-2482s21c1
Sequence:CCGGCACACAAAGACCCACTAATTTCTCGAGAAATTAGTGGGTCTTTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001038640.2-718s21c1
Sequence:CCGGAGCTAGAGCGAGACGAATATGCTCGAGCATATTCGTCTCGCTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)