EMAIL THIS PAGE TO A FRIEND

GOLGA6L1

golgin A6 family-like 1

22 Gene Product Result for
Species: Human GOLGA6L1(283767)
UniProtKB ID: Q8N7Z2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001413 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001413 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001413 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001413 Rosetta Predictions human pricing
XM_929339 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001413 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303736 predicted 657
2 SASI_Hs02_00303737 predicted 509
3 SASI_Hs02_00303738 predicted 587
4 SASI_Hs02_00303739 predicted 506
5 SASI_Hs02_00303740 predicted 628
6 SASI_Hs02_00303741 predicted 658
7 SASI_Hs02_00303742 predicted 594
8 SASI_Hs02_00303743 predicted 595
9 SASI_Hs02_00303744 predicted 520
10 SASI_Hs02_00303745 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252570 predicted 653
2 SASI_Hs01_00252571 predicted 500
3 SASI_Hs01_00252572 predicted 579
4 SASI_Hs01_00252573 predicted 505
5 SASI_Hs01_00252574 predicted 628
6 SASI_Hs01_00252575 predicted 712
7 SASI_Hs01_00252576 predicted 663
8 SASI_Hs01_00252577 predicted 601
9 SASI_Hs01_00252578 predicted 600
10 SASI_Hs01_00252579 predicted 518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001413
GOLGA6L1 MISSION shRNA Bacterial Glycerol Stock
golgin A6 family-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001413.2-251s21c1
Sequence:CCGGGAAACCAGACAGAGCAAATTGCTCGAGCAATTTGCTCTGTCTGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001413.2-667s21c1
Sequence:CCGGTAGGTACATTGAGGAGTTAACCTCGAGGTTAACTCCTCAATGTACCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001413.2-1503s21c1
Sequence:CCGGTAAGGGAGCAGGAGGAGATATCTCGAGATATCTCCTCCTGCTCCCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001413.2-806s21c1
Sequence:CCGGGAGATCCAGCTCAACGTAAAGCTCGAGCTTTACGTTGAGCTGGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001413.2-2147s21c1
Sequence:CCGGCGCCTGTAATCCTAGCAATTTCTCGAGAAATTGCTAGGATTACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001413
GOLGA6L1 MISSION shRNA shRNA Plasmid DNA
golgin A6 family-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001413.2-251s21c1
Sequence:CCGGGAAACCAGACAGAGCAAATTGCTCGAGCAATTTGCTCTGTCTGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001413.2-667s21c1
Sequence:CCGGTAGGTACATTGAGGAGTTAACCTCGAGGTTAACTCCTCAATGTACCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001413.2-1503s21c1
Sequence:CCGGTAAGGGAGCAGGAGGAGATATCTCGAGATATCTCCTCCTGCTCCCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001413.2-806s21c1
Sequence:CCGGGAGATCCAGCTCAACGTAAAGCTCGAGCTTTACGTTGAGCTGGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001413.2-2147s21c1
Sequence:CCGGCGCCTGTAATCCTAGCAATTTCTCGAGAAATTGCTAGGATTACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001413
GOLGA6L1 MISSION shRNA Lentiviral Transduction Particles
golgin A6 family-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001413.2-251s21c1
Sequence:CCGGGAAACCAGACAGAGCAAATTGCTCGAGCAATTTGCTCTGTCTGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001413.2-667s21c1
Sequence:CCGGTAGGTACATTGAGGAGTTAACCTCGAGGTTAACTCCTCAATGTACCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001413.2-1503s21c1
Sequence:CCGGTAAGGGAGCAGGAGGAGATATCTCGAGATATCTCCTCCTGCTCCCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001413.2-806s21c1
Sequence:CCGGGAGATCCAGCTCAACGTAAAGCTCGAGCTTTACGTTGAGCTGGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001413.2-2147s21c1
Sequence:CCGGCGCCTGTAATCCTAGCAATTTCTCGAGAAATTGCTAGGATTACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)