EMAIL THIS PAGE TO A FRIEND

GOLGA6L5

golgin A6 family-like 5 (pseudogene)

22 Gene Product Result for
Synonyms: GOLGA6L8
Species: Human GOLGA6L5(374650)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198079 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003246 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378878 predicted 3595
2 SASI_Hs02_00378879 predicted 3501
3 SASI_Hs02_00378880 predicted 3770
4 SASI_Hs02_00378881 predicted 2457
5 SASI_Hs02_00378882 predicted 3796
6 SASI_Hs02_00378883 predicted 3394
7 SASI_Hs02_00378884 predicted 3636
8 SASI_Hs02_00378885 predicted 2392
9 SASI_Hs02_00378886 predicted 4148
10 SASI_Hs02_00378887 predicted 3981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198079
GOLGA6L5 MISSION shRNA Bacterial Glycerol Stock
golgin A6 family-like 5 (pseudogene)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198079.1-428s1c1
Sequence:CCGGGAGAAGAAGCATGAGATACATCTCGAGATGTATCTCATGCTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198079.1-466s1c1
Sequence:CCGGGAGGAGCTTGTTCAAACTCAACTCGAGTTGAGTTTGAACAAGCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198079.1-436s1c1
Sequence:CCGGGCATGAGATACATCTGGTACACTCGAGTGTACCAGATGTATCTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198079.1-1169s1c1
Sequence:CCGGGAAGAGGTGGAGAAGCTGTTACTCGAGTAACAGCTTCTCCACCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198079.1-425s1c1
Sequence:CCGGGAGGAGAAGAAGCATGAGATACTCGAGTATCTCATGCTTCTTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198079
GOLGA6L5 MISSION shRNA shRNA Plasmid DNA
golgin A6 family-like 5 (pseudogene)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198079.1-428s1c1
Sequence:CCGGGAGAAGAAGCATGAGATACATCTCGAGATGTATCTCATGCTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198079.1-466s1c1
Sequence:CCGGGAGGAGCTTGTTCAAACTCAACTCGAGTTGAGTTTGAACAAGCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198079.1-436s1c1
Sequence:CCGGGCATGAGATACATCTGGTACACTCGAGTGTACCAGATGTATCTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198079.1-1169s1c1
Sequence:CCGGGAAGAGGTGGAGAAGCTGTTACTCGAGTAACAGCTTCTCCACCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198079.1-425s1c1
Sequence:CCGGGAGGAGAAGAAGCATGAGATACTCGAGTATCTCATGCTTCTTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198079
GOLGA6L5 MISSION shRNA Lentiviral Transduction Particles
golgin A6 family-like 5 (pseudogene)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198079.1-428s1c1
Sequence:CCGGGAGAAGAAGCATGAGATACATCTCGAGATGTATCTCATGCTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198079.1-466s1c1
Sequence:CCGGGAGGAGCTTGTTCAAACTCAACTCGAGTTGAGTTTGAACAAGCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198079.1-436s1c1
Sequence:CCGGGCATGAGATACATCTGGTACACTCGAGTGTACCAGATGTATCTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198079.1-1169s1c1
Sequence:CCGGGAAGAGGTGGAGAAGCTGTTACTCGAGTAACAGCTTCTCCACCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198079.1-425s1c1
Sequence:CCGGGAGGAGAAGAAGCATGAGATACTCGAGTATCTCATGCTTCTTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)