EMAIL THIS PAGE TO A FRIEND

GOPC

golgi-associated PDZ and coiled-coil motif containing

222 Gene Product Result for
Synonyms: CAL FIG GOPC1 PIST dJ94G16.2
UniProtKB ID: Q9HD26, A6NM30, Q59FS4, Q969U8
Gene ID:
Human(57120) Summary: This gene encodes a Golgi protein with a PDZ domain. The PDZ domain is globular and proteins which contain them bind other proteins through short motifs near the C-termini. Mice which are deficient in the orthologous protein have globozoospermia and are infertile. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(94221) golgi associated PDZ and coiled-coil motif containing
Rat(309774) golgi associated PDZ and coiled-coil motif containing
Zebrafish(326887) golgi associated PDZ and coiled-coil motif containing
dog(484100) golgi-associated PDZ and coiled-coil motif containing
cow(541186) golgi-associated PDZ and coiled-coil motif containing
domestic cat(101097151) golgi-associated PDZ and coiled-coil motif containing
chicken(770364) golgi-associated PDZ and coiled-coil motif containing
domestic guinea pig(100718553) golgi-associated PDZ and coiled-coil motif containing
naked mole-rat(101701198) golgi-associated PDZ and coiled-coil motif containing
sheep(101103071) golgi-associated PDZ and coiled-coil motif containing
Domestic Rabbit(100338749) golgi-associated PDZ and coiled-coil motif containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA024018 Anti-GOPC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA019477 Anti-GOPC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunofluorescence, immunohistochemistry pricing
SAB2104168 Anti-GOPC antibody produced in rabbit affinity isolated antibody mouse, horse, rat, bovine, rabbit, human, canine, guinea pig
western blot pricing
SAB2104167 Anti-GOPC, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, bovine, rat, human, mouse, rabbit, canine, zebrafish
western blot pricing
SAB1306367 ANTI-PIST (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB3500332 Anti-PIST antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306366 ANTI-PIST(C-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB2500797 Anti-PIST/FIG/GOPC antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine, canine
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053187 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053187 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053187 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020399 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017408 Rosetta Predictions human pricing
NM_020399 Rosetta Predictions human pricing
NM_001107631 Rosetta Predictions rat pricing
NM_053187 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226055 predicted 1472
2 SASI_Hs01_00226056 predicted 1592
3 SASI_Hs01_00226058 predicted 1531
4 SASI_Hs01_00226060 predicted 1242
5 SASI_Hs01_00226061 predicted 1244
6 SASI_Hs01_00226062 predicted 1347
7 SASI_Hs01_00226063 predicted 1377
8 SASI_Hs01_00226064 predicted 1017
9 SASI_Hs02_00306739 predicted 1221
10 SASI_Hs02_00306740 predicted 420
11 SASI_Hs01_00226057 predicted 1455
12 SASI_Hs01_00226059 predicted 1419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183150 predicted 1496
2 SASI_Hs01_00183151 predicted 1624
3 SASI_Hs01_00183154 predicted 1551
4 SASI_Hs01_00183156 predicted 1273
5 SASI_Hs01_00183157 predicted 1269
6 SASI_Hs01_00183158 predicted 1375
7 SASI_Hs01_00183159 predicted 1401
8 SASI_Hs02_00353382 predicted 1034
9 SASI_Hs02_00353383 predicted 1245
10 SASI_Hs02_00353384 predicted 424
11 SASI_Hs01_00183152 predicted 1284
12 SASI_Hs01_00183153 predicted 1477
13 SASI_Hs01_00183155 predicted 1445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230735 predicted 637
2 SASI_Rn02_00230736 predicted 874
3 SASI_Rn02_00230737 predicted 1347
4 SASI_Rn02_00230738 predicted 1172
5 SASI_Rn02_00230739 predicted 980
6 SASI_Rn02_00230740 predicted 825
7 SASI_Rn02_00230741 predicted 1332
8 SASI_Rn02_00230742 predicted 1049
9 SASI_Rn02_00230743 predicted 1228
10 SASI_Rn02_00230744 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053187 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025182 predicted 1037
2 SASI_Mm01_00025183 predicted 1199
3 SASI_Mm01_00025184 predicted 1597
4 SASI_Mm01_00025185 predicted 671
5 SASI_Mm01_00025186 predicted 1341
6 SASI_Mm01_00025187 predicted 817
7 SASI_Mm01_00025188 predicted 1185
8 SASI_Mm02_00337747 predicted 1236
9 SASI_Mm02_00337748 predicted 1298
10 SASI_Mm01_00025190 predicted 1408
11 SASI_Mm01_00025189 predicted 1333
12 SASI_Mm01_00025191 predicted 1149
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053187
VALIDATED
GOPC MISSION shRNA Bacterial Glycerol Stock
golgi-associated PDZ and coiled-coil motif containing
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053187.2-1273s1c1
Sequence:CCGGGAAGTGGATTCTGACGATGAACTCGAGTTCATCGTCAGAATCCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193490    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053187.2-3033s1c1
Sequence:CCGGGCCTGTAAACAAGGTTAGTATCTCGAGATACTAACCTTGTTTACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-1186s1c1
Sequence:CCGGCTAAGAGACACAAAGCATAAACTCGAGTTTATGCTTTGTGTCTCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-1331s1c1
Sequence:CCGGGTCTGTATCTTGACGAGTTAGCTCGAGCTAACTCGTCAAGATACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-819s1c1
Sequence:CCGGACAATTACTGGGACGGGATATCTCGAGATATCCCGTCCCAGTAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-579s1c1
Sequence:CCGGTCATGCCAAGACTGGTCAAAGCTCGAGCTTTGACCAGTCTTGGCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-475s1c1
Sequence:CCGGGTGGATCTGCGATCGGAATTGCTCGAGCAATTCCGATCGCAGATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053187.2-1186s21c1
Sequence:CCGGCTAAGAGACACAAAGCATAAACTCGAGTTTATGCTTTGTGTCTCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053187.2-819s21c1
Sequence:CCGGACAATTACTGGGACGGGATATCTCGAGATATCCCGTCCCAGTAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053187.2-579s21c1
Sequence:CCGGTCATGCCAAGACTGGTCAAAGCTCGAGCTTTGACCAGTCTTGGCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053187.2-475s21c1
Sequence:CCGGGTGGATCTGCGATCGGAATTGCTCGAGCAATTCCGATCGCAGATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053187
VALIDATED
GOPC MISSION shRNA shRNA Plasmid DNA
golgi-associated PDZ and coiled-coil motif containing
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053187.2-1273s1c1
Sequence:CCGGGAAGTGGATTCTGACGATGAACTCGAGTTCATCGTCAGAATCCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193490    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053187.2-3033s1c1
Sequence:CCGGGCCTGTAAACAAGGTTAGTATCTCGAGATACTAACCTTGTTTACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-1186s1c1
Sequence:CCGGCTAAGAGACACAAAGCATAAACTCGAGTTTATGCTTTGTGTCTCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-1331s1c1
Sequence:CCGGGTCTGTATCTTGACGAGTTAGCTCGAGCTAACTCGTCAAGATACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-819s1c1
Sequence:CCGGACAATTACTGGGACGGGATATCTCGAGATATCCCGTCCCAGTAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-579s1c1
Sequence:CCGGTCATGCCAAGACTGGTCAAAGCTCGAGCTTTGACCAGTCTTGGCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-475s1c1
Sequence:CCGGGTGGATCTGCGATCGGAATTGCTCGAGCAATTCCGATCGCAGATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053187.2-1186s21c1
Sequence:CCGGCTAAGAGACACAAAGCATAAACTCGAGTTTATGCTTTGTGTCTCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053187.2-819s21c1
Sequence:CCGGACAATTACTGGGACGGGATATCTCGAGATATCCCGTCCCAGTAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053187.2-579s21c1
Sequence:CCGGTCATGCCAAGACTGGTCAAAGCTCGAGCTTTGACCAGTCTTGGCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053187.2-475s21c1
Sequence:CCGGGTGGATCTGCGATCGGAATTGCTCGAGCAATTCCGATCGCAGATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053187
VALIDATED
GOPC MISSION shRNA Lentiviral Transduction Particles
golgi-associated PDZ and coiled-coil motif containing
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_053187.2-1273s1c1
Sequence:CCGGGAAGTGGATTCTGACGATGAACTCGAGTTCATCGTCAGAATCCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193490    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_053187.2-3033s1c1
Sequence:CCGGGCCTGTAAACAAGGTTAGTATCTCGAGATACTAACCTTGTTTACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-1186s1c1
Sequence:CCGGCTAAGAGACACAAAGCATAAACTCGAGTTTATGCTTTGTGTCTCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-1331s1c1
Sequence:CCGGGTCTGTATCTTGACGAGTTAGCTCGAGCTAACTCGTCAAGATACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-819s1c1
Sequence:CCGGACAATTACTGGGACGGGATATCTCGAGATATCCCGTCCCAGTAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-579s1c1
Sequence:CCGGTCATGCCAAGACTGGTCAAAGCTCGAGCTTTGACCAGTCTTGGCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_053187.2-475s1c1
Sequence:CCGGGTGGATCTGCGATCGGAATTGCTCGAGCAATTCCGATCGCAGATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053187.2-1186s21c1
Sequence:CCGGCTAAGAGACACAAAGCATAAACTCGAGTTTATGCTTTGTGTCTCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053187.2-819s21c1
Sequence:CCGGACAATTACTGGGACGGGATATCTCGAGATATCCCGTCCCAGTAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053187.2-579s21c1
Sequence:CCGGTCATGCCAAGACTGGTCAAAGCTCGAGCTTTGACCAGTCTTGGCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053187.2-475s21c1
Sequence:CCGGGTGGATCTGCGATCGGAATTGCTCGAGCAATTCCGATCGCAGATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020399
VALIDATED
GOPC MISSION shRNA Bacterial Glycerol Stock
golgi-associated PDZ and coiled-coil motif containing
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020399.1-1244s1c1
Sequence:CCGGCGTTACCGTTTGTACCTTGATCTCGAGATCAAGGTACAAACGGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020399.1-328s1c1
Sequence:CCGGCCAGTCTGTGTCTCAAATCAACTCGAGTTGATTTGAGACACAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020399.1-1116s1c1
Sequence:CCGGCAAAGCATAAAGAAGCTGTAACTCGAGTTACAGCTTCTTTATGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020399.1-185s1c1
Sequence:CCGGCTGGAGAAGGAGTTCGACAAACTCGAGTTTGTCGAACTCCTTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-813s21c1
Sequence:GTACCGGGTTCTCCAGGCTGAAGTATATCTCGAGATATACTTCAGCCTGGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020399.2-1625s21c1
Sequence:GTACCGGCCATATCTCCAGACAAGATTGCTCGAGCAATCTTGTCTGGAGATATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-1790s21c1
Sequence:CCGGTTCTGTGGTAGACCATAATTACTCGAGTAATTATGGTCTACCACAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-339s21c1
Sequence:CCGGCTGGAGAAGGAGTTCGACAAACTCGAGTTTGTCGAACTCCTTCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-930s21c1
Sequence:GTACCGGGATAAGCTTTGGAACCAATTACTCGAGTAATTGGTTCCAAAGCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-1044s21c1
Sequence:GTACCGGCATGATCAAGATTCCCTAAAGCTCGAGCTTTAGGGAATCTTGATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-1586s21c1
Sequence:GTACCGGTCTGCACACTCTGTATCATAACTCGAGTTATGATACAGAGTGTGCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-893s21c1
Sequence:CCGGACAATTGCTAGGACGAGATATCTCGAGATATCTCGTCCTAGCAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-788s21c1
Sequence:CCGGTGAAGCCCTTCGTAGACATATCTCGAGATATGTCTACGAAGGGCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-1069s21c1
Sequence:CCGGGCCAAGGTGTTGGTCCAATTACTCGAGTAATTGGACCAACACCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-752s21c1
Sequence:GTACCGGACTTGAAGCTGAAGTGAAATTCTCGAGAATTTCACTTCAGCTTCAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-1261s21c1
Sequence:GTACCGGTAAGGGACACAAAGCATAAAGCTCGAGCTTTATGCTTTGTGTCCCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-402s21c1
Sequence:GTACCGGGACCAAGCGGACATCACTTATCTCGAGATAAGTGATGTCCGCTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020399
VALIDATED
GOPC MISSION shRNA shRNA Plasmid DNA
golgi-associated PDZ and coiled-coil motif containing
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020399.1-1244s1c1
Sequence:CCGGCGTTACCGTTTGTACCTTGATCTCGAGATCAAGGTACAAACGGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020399.1-328s1c1
Sequence:CCGGCCAGTCTGTGTCTCAAATCAACTCGAGTTGATTTGAGACACAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020399.1-1116s1c1
Sequence:CCGGCAAAGCATAAAGAAGCTGTAACTCGAGTTACAGCTTCTTTATGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020399.1-185s1c1
Sequence:CCGGCTGGAGAAGGAGTTCGACAAACTCGAGTTTGTCGAACTCCTTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-813s21c1
Sequence:GTACCGGGTTCTCCAGGCTGAAGTATATCTCGAGATATACTTCAGCCTGGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020399.2-1625s21c1
Sequence:GTACCGGCCATATCTCCAGACAAGATTGCTCGAGCAATCTTGTCTGGAGATATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-1790s21c1
Sequence:CCGGTTCTGTGGTAGACCATAATTACTCGAGTAATTATGGTCTACCACAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-339s21c1
Sequence:CCGGCTGGAGAAGGAGTTCGACAAACTCGAGTTTGTCGAACTCCTTCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-930s21c1
Sequence:GTACCGGGATAAGCTTTGGAACCAATTACTCGAGTAATTGGTTCCAAAGCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-1044s21c1
Sequence:GTACCGGCATGATCAAGATTCCCTAAAGCTCGAGCTTTAGGGAATCTTGATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-1586s21c1
Sequence:GTACCGGTCTGCACACTCTGTATCATAACTCGAGTTATGATACAGAGTGTGCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-893s21c1
Sequence:CCGGACAATTGCTAGGACGAGATATCTCGAGATATCTCGTCCTAGCAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-788s21c1
Sequence:CCGGTGAAGCCCTTCGTAGACATATCTCGAGATATGTCTACGAAGGGCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-1069s21c1
Sequence:CCGGGCCAAGGTGTTGGTCCAATTACTCGAGTAATTGGACCAACACCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-752s21c1
Sequence:GTACCGGACTTGAAGCTGAAGTGAAATTCTCGAGAATTTCACTTCAGCTTCAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-1261s21c1
Sequence:GTACCGGTAAGGGACACAAAGCATAAAGCTCGAGCTTTATGCTTTGTGTCCCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-402s21c1
Sequence:GTACCGGGACCAAGCGGACATCACTTATCTCGAGATAAGTGATGTCCGCTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020399
VALIDATED
GOPC MISSION shRNA Lentiviral Transduction Particles
golgi-associated PDZ and coiled-coil motif containing
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020399.1-1244s1c1
Sequence:CCGGCGTTACCGTTTGTACCTTGATCTCGAGATCAAGGTACAAACGGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_020399.1-328s1c1
Sequence:CCGGCCAGTCTGTGTCTCAAATCAACTCGAGTTGATTTGAGACACAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020399.1-1116s1c1
Sequence:CCGGCAAAGCATAAAGAAGCTGTAACTCGAGTTACAGCTTCTTTATGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_020399.1-185s1c1
Sequence:CCGGCTGGAGAAGGAGTTCGACAAACTCGAGTTTGTCGAACTCCTTCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-813s21c1
Sequence:GTACCGGGTTCTCCAGGCTGAAGTATATCTCGAGATATACTTCAGCCTGGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020399.2-1625s21c1
Sequence:GTACCGGCCATATCTCCAGACAAGATTGCTCGAGCAATCTTGTCTGGAGATATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-1790s21c1
Sequence:CCGGTTCTGTGGTAGACCATAATTACTCGAGTAATTATGGTCTACCACAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-339s21c1
Sequence:CCGGCTGGAGAAGGAGTTCGACAAACTCGAGTTTGTCGAACTCCTTCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-930s21c1
Sequence:GTACCGGGATAAGCTTTGGAACCAATTACTCGAGTAATTGGTTCCAAAGCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-1044s21c1
Sequence:GTACCGGCATGATCAAGATTCCCTAAAGCTCGAGCTTTAGGGAATCTTGATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-1586s21c1
Sequence:GTACCGGTCTGCACACTCTGTATCATAACTCGAGTTATGATACAGAGTGTGCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-893s21c1
Sequence:CCGGACAATTGCTAGGACGAGATATCTCGAGATATCTCGTCCTAGCAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-788s21c1
Sequence:CCGGTGAAGCCCTTCGTAGACATATCTCGAGATATGTCTACGAAGGGCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_020399.2-1069s21c1
Sequence:CCGGGCCAAGGTGTTGGTCCAATTACTCGAGTAATTGGACCAACACCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-752s21c1
Sequence:GTACCGGACTTGAAGCTGAAGTGAAATTCTCGAGAATTTCACTTCAGCTTCAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-1261s21c1
Sequence:GTACCGGTAAGGGACACAAAGCATAAAGCTCGAGCTTTATGCTTTGTGTCCCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020399.2-402s21c1
Sequence:GTACCGGGACCAAGCGGACATCACTTATCTCGAGATAAGTGATGTCCGCTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)