EMAIL THIS PAGE TO A FRIEND

GOT2

glutamic-oxaloacetic transaminase 2, mitochondrial

78 Gene Product Result for
Synonyms: KAT4 KATIV mitAAT
UniProtKB ID: P00505, Q53FL3, Q9BWA3
Gene ID:
Human(2806) Summary: Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and inner-membrane mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. [provided by RefSeq, Jul 2008]
Mouse(14719) glutamate oxaloacetate transaminase 2, mitochondrial
Rat(25721) glutamic-oxaloacetic transaminase 2, mitochondrial
fruit fly(33373) Glutamate oxaloacetate transaminase 2
chicken(396533) glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)
dog(478103) glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)
cow(286886) glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)
domestic cat(101090160) glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)
domestic guinea pig(100718036) glutamate oxaloacetate transaminase 2, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500475 Anti-GOT2 (AA 295-306) antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
AV43517 Anti-GOT2 (AB1) antibody produced in rabbit IgG fraction of antiserum yeast, bovine, rabbit, guinea pig, mouse, human, horse, rat
western blot pricing
AV43518 Anti-GOT2 (AB2) antibody produced in rabbit IgG fraction of antiserum rabbit, rat, dog, guinea pig, human, horse, bovine, mouse
immunohistochemistry, western blot pricing
HPA018139 Anti-GOT2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, rat, mouse
immunohistochemistry, western blot pricing
SAB2100950 Anti-GOT2 antibody produced in rabbit affinity isolated antibody bovine, rat, human, yeast, horse, guinea pig, rabbit, mouse
western blot pricing
MABS417 Anti-GOT2, clone 3E9 Antibody ascites fluid, clone 3E9, from mouse mouse, monkey, rat, human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002080 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002080 Rosetta Predictions human pricing
NM_013177 Rosetta Predictions rat pricing
NM_010325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060074 predicted 257 154.00
2 SASI_Hs02_00333156 predicted 1441 154.00
3 SASI_Hs02_00333157 predicted 1301 154.00
4 SASI_Hs01_00060075 predicted 988 154.00
5 SASI_Hs01_00060076 predicted 498 154.00
6 SASI_Hs01_00060077 predicted 1452 154.00
7 SASI_Hs01_00060078 predicted 308 154.00
8 SASI_Hs01_00060079 predicted 1240 154.00
9 SASI_Hs01_00060080 predicted 720 154.00
10 SASI_Hs01_00060081 predicted 261 154.00
11 SASI_Hs01_00060082 predicted 518 154.00
12 SASI_Hs01_00060083 predicted 440 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013177 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055610 predicted 1494 154.00
2 SASI_Rn01_00055612 predicted 289 154.00
3 SASI_Rn01_00055613 predicted 1616 154.00
4 SASI_Rn01_00055614 predicted 1564 154.00
5 SASI_Rn02_00261003 predicted 1584 154.00
6 SASI_Rn01_00055619 predicted 232 154.00
7 SASI_Rn02_00261004 predicted 474 154.00
8 SASI_Rn02_00261005 predicted 431 154.00
9 SASI_Rn02_00261006 predicted 242 154.00
10 SASI_Rn02_00261007 predicted 240 154.00
11 SASI_Rn01_00055611 predicted 1465 154.00
12 SASI_Rn01_00055615 predicted 926 154.00
13 SASI_Rn01_00055616 predicted 1277 154.00
14 SASI_Rn01_00055617 predicted 1276 154.00
15 SASI_Rn01_00055618 predicted 1287 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136452 predicted 1243 154.00
2 SASI_Mm01_00136453 predicted 1314 154.00
3 SASI_Mm01_00136454 predicted 541 154.00
4 SASI_Mm01_00136455 predicted 1325 154.00
5 SASI_Mm01_00136456 predicted 1368 154.00
6 SASI_Mm01_00136458 predicted 1343 154.00
7 SASI_Mm02_00318330 predicted 204 154.00
8 SASI_Mm02_00318331 predicted 338 154.00
9 SASI_Mm02_00318332 predicted 214 154.00
10 SASI_Mm01_00136459 predicted 512 154.00
11 SASI_Mm01_00136457 predicted 1465 154.00
12 SASI_Mm01_00136460 predicted 1543 154.00
13 SASI_Mm01_00136461 predicted 1077 154.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010325
GOT2 MISSION shRNA Bacterial Glycerol Stock
glutamic-oxaloacetic transaminase 2, mitochondrial
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010325.2-1200s21c1
Sequence:CCGGGTTCTGTTTCACCGGCCTAAACTCGAGTTTAGGCCGGTGAAACAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010325.2-1814s21c1
Sequence:CCGGGCAGACCACATTACAGAAATTCTCGAGAATTTCTGTAATGTGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010325.2-638s21c1
Sequence:CCGGGAGCCCTAGAAGACATATCAACTCGAGTTGATATGTCTTCTAGGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010325.2-585s21c1
Sequence:CCGGGCTCCAAGGTTATCGCTACTACTCGAGTAGTAGCGATAACCTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010325.1-882s1c1
Sequence:CCGGCCAATCGTATGCCAAGAACATCTCGAGATGTTCTTGGCATACGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010325.1-1814s1c1
Sequence:CCGGGCAGACCACATTACAGAAATTCTCGAGAATTTCTGTAATGTGGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010325.1-585s1c1
Sequence:CCGGGCTCCAAGGTTATCGCTACTACTCGAGTAGTAGCGATAACCTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010325.1-1200s1c1
Sequence:CCGGGTTCTGTTTCACCGGCCTAAACTCGAGTTTAGGCCGGTGAAACAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010325.1-638s1c1
Sequence:CCGGGAGCCCTAGAAGACATATCAACTCGAGTTGATATGTCTTCTAGGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010325
GOT2 MISSION shRNA shRNA Plasmid DNA
glutamic-oxaloacetic transaminase 2, mitochondrial
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010325.2-1200s21c1
Sequence:CCGGGTTCTGTTTCACCGGCCTAAACTCGAGTTTAGGCCGGTGAAACAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010325.2-1814s21c1
Sequence:CCGGGCAGACCACATTACAGAAATTCTCGAGAATTTCTGTAATGTGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010325.2-638s21c1
Sequence:CCGGGAGCCCTAGAAGACATATCAACTCGAGTTGATATGTCTTCTAGGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010325.2-585s21c1
Sequence:CCGGGCTCCAAGGTTATCGCTACTACTCGAGTAGTAGCGATAACCTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010325.1-882s1c1
Sequence:CCGGCCAATCGTATGCCAAGAACATCTCGAGATGTTCTTGGCATACGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010325.1-1814s1c1
Sequence:CCGGGCAGACCACATTACAGAAATTCTCGAGAATTTCTGTAATGTGGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010325.1-585s1c1
Sequence:CCGGGCTCCAAGGTTATCGCTACTACTCGAGTAGTAGCGATAACCTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010325.1-1200s1c1
Sequence:CCGGGTTCTGTTTCACCGGCCTAAACTCGAGTTTAGGCCGGTGAAACAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010325.1-638s1c1
Sequence:CCGGGAGCCCTAGAAGACATATCAACTCGAGTTGATATGTCTTCTAGGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010325
GOT2 MISSION shRNA Lentiviral Transduction Particles
glutamic-oxaloacetic transaminase 2, mitochondrial
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010325.2-1200s21c1
Sequence:CCGGGTTCTGTTTCACCGGCCTAAACTCGAGTTTAGGCCGGTGAAACAGAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000326020    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010325.2-1814s21c1
Sequence:CCGGGCAGACCACATTACAGAAATTCTCGAGAATTTCTGTAATGTGGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000325946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010325.2-638s21c1
Sequence:CCGGGAGCCCTAGAAGACATATCAACTCGAGTTGATATGTCTTCTAGGGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000325948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010325.2-585s21c1
Sequence:CCGGGCTCCAAGGTTATCGCTACTACTCGAGTAGTAGCGATAACCTTGGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010325.1-882s1c1
Sequence:CCGGCCAATCGTATGCCAAGAACATCTCGAGATGTTCTTGGCATACGATTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010325.1-1814s1c1
Sequence:CCGGGCAGACCACATTACAGAAATTCTCGAGAATTTCTGTAATGTGGTCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010325.1-585s1c1
Sequence:CCGGGCTCCAAGGTTATCGCTACTACTCGAGTAGTAGCGATAACCTTGGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010325.1-1200s1c1
Sequence:CCGGGTTCTGTTTCACCGGCCTAAACTCGAGTTTAGGCCGGTGAAACAGAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010325.1-638s1c1
Sequence:CCGGGAGCCCTAGAAGACATATCAACTCGAGTTGATATGTCTTCTAGGGCTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002080
VALIDATED
GOT2 MISSION shRNA Bacterial Glycerol Stock
glutamic-oxaloacetic transaminase 2, mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-262s21c1
Sequence:CCGGGCCTTTAAGAGGGACACCAATCTCGAGATTGGTGTCCCTCTTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-1227s21c1
Sequence:CCGGGCAACACATCACCGACCAAATCTCGAGATTTGGTCGGTGATGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-982s21c1
Sequence:CCGGGCCTTCACTATGGTCTGCAAACTCGAGTTTGCAGACCATAGTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-876s1c1
Sequence:CCGGGCCTTCACTATGGTCTGCAAACTCGAGTTTGCAGACCATAGTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-533s1c1
Sequence:CCGGGCTACAAGGTTATCGGTATTACTCGAGTAATACCGATAACCTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-156s1c1
Sequence:CCGGGCCTTTAAGAGGGACACCAATCTCGAGATTGGTGTCCCTCTTAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-1121s1c1
Sequence:CCGGGCAACACATCACCGACCAAATCTCGAGATTTGGTCGGTGATGTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-465s1c1
Sequence:CCGGCGAGATGTCTTTCTGCCCAAACTCGAGTTTGGGCAGAAAGACATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-571s21c1
Sequence:CCGGCGAGATGTCTTTCTGCCCAAACTCGAGTTTGGGCAGAAAGACATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-639s21c1
Sequence:CCGGGCTACAAGGTTATCGGTATTACTCGAGTAATACCGATAACCTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002080
VALIDATED
GOT2 MISSION shRNA shRNA Plasmid DNA
glutamic-oxaloacetic transaminase 2, mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-262s21c1
Sequence:CCGGGCCTTTAAGAGGGACACCAATCTCGAGATTGGTGTCCCTCTTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-1227s21c1
Sequence:CCGGGCAACACATCACCGACCAAATCTCGAGATTTGGTCGGTGATGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-982s21c1
Sequence:CCGGGCCTTCACTATGGTCTGCAAACTCGAGTTTGCAGACCATAGTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-876s1c1
Sequence:CCGGGCCTTCACTATGGTCTGCAAACTCGAGTTTGCAGACCATAGTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-533s1c1
Sequence:CCGGGCTACAAGGTTATCGGTATTACTCGAGTAATACCGATAACCTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-156s1c1
Sequence:CCGGGCCTTTAAGAGGGACACCAATCTCGAGATTGGTGTCCCTCTTAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-1121s1c1
Sequence:CCGGGCAACACATCACCGACCAAATCTCGAGATTTGGTCGGTGATGTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-465s1c1
Sequence:CCGGCGAGATGTCTTTCTGCCCAAACTCGAGTTTGGGCAGAAAGACATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-571s21c1
Sequence:CCGGCGAGATGTCTTTCTGCCCAAACTCGAGTTTGGGCAGAAAGACATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-639s21c1
Sequence:CCGGGCTACAAGGTTATCGGTATTACTCGAGTAATACCGATAACCTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002080
VALIDATED
GOT2 MISSION shRNA Lentiviral Transduction Particles
glutamic-oxaloacetic transaminase 2, mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-262s21c1
Sequence:CCGGGCCTTTAAGAGGGACACCAATCTCGAGATTGGTGTCCCTCTTAAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-1227s21c1
Sequence:CCGGGCAACACATCACCGACCAAATCTCGAGATTTGGTCGGTGATGTGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000307910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-982s21c1
Sequence:CCGGGCCTTCACTATGGTCTGCAAACTCGAGTTTGCAGACCATAGTGAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000034824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-876s1c1
Sequence:CCGGGCCTTCACTATGGTCTGCAAACTCGAGTTTGCAGACCATAGTGAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000034827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-533s1c1
Sequence:CCGGGCTACAAGGTTATCGGTATTACTCGAGTAATACCGATAACCTTGTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000034828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-156s1c1
Sequence:CCGGGCCTTTAAGAGGGACACCAATCTCGAGATTGGTGTCCCTCTTAAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000034826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-1121s1c1
Sequence:CCGGGCAACACATCACCGACCAAATCTCGAGATTTGGTCGGTGATGTGTTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000034825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_002080.1-465s1c1
Sequence:CCGGCGAGATGTCTTTCTGCCCAAACTCGAGTTTGGGCAGAAAGACATCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-571s21c1
Sequence:CCGGCGAGATGTCTTTCTGCCCAAACTCGAGTTTGGGCAGAAAGACATCTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000291991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002080.2-639s21c1
Sequence:CCGGGCTACAAGGTTATCGGTATTACTCGAGTAATACCGATAACCTTGTAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???