EMAIL THIS PAGE TO A FRIEND

GPBAR1

G protein-coupled bile acid receptor 1

74 Gene Product Result for
Synonyms: BG37 GPCR19 GPR131 M-BAR TGR5
UniProtKB ID: Q8TDU6, B3KV35
Gene ID:
Human(151306) Summary: This gene encodes a member of the G protein-coupled receptor (GPCR) superfamily. This enzyme functions as a cell surface receptor for bile acids. Treatment of cells expressing this GPCR with bile acids induces the production of intracellular cAMP, activation of a MAP kinase signaling pathway, and internalization of the receptor. The receptor is implicated in the suppression of macrophage functions and regulation of energy homeostasis by bile acids. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(227289) G protein-coupled bile acid receptor 1
Rat(338443) G protein-coupled bile acid receptor 1
dog(488521) G protein-coupled bile acid receptor 1
domestic cat(101089457) G protein-coupled bile acid receptor 1
cow(317756) G protein-coupled bile acid receptor 1
sheep(101109073) G protein-coupled bile acid receptor 1
domestic guinea pig(100723590) G protein-coupled bile acid receptor 1
naked mole-rat(101710900) G protein-coupled bile acid receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170699 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174985 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174985 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174985 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077191 Rosetta Predictions human pricing
NM_001077194 Rosetta Predictions human pricing
NM_170699 Rosetta Predictions human pricing
NM_177936 Rosetta Predictions rat pricing
NM_174985 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312134 predicted 1599
2 SASI_Hs02_00312135 predicted 1546
3 SASI_Hs02_00312136 predicted 1192
4 SASI_Hs02_00312137 predicted 1123
5 SASI_Hs02_00312138 predicted 1485
6 SASI_Hs02_00312139 predicted 1411
7 SASI_Hs02_00312140 predicted 1641
8 SASI_Hs02_00312141 predicted 1129
9 SASI_Hs02_00312142 predicted 1835
10 SASI_Hs02_00312143 predicted 1831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312144 predicted 1092
2 SASI_Hs02_00312145 predicted 1038
3 SASI_Hs02_00312146 predicted 686
4 SASI_Hs02_00312147 predicted 612
5 SASI_Hs02_00312148 predicted 975
6 SASI_Hs02_00312149 predicted 900
7 SASI_Hs02_00312150 predicted 1139
8 SASI_Hs02_00312151 predicted 614
9 SASI_Hs02_00312152 predicted 1327
10 SASI_Hs02_00312153 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170699 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133511 predicted 979
2 SASI_Hs01_00133512 predicted 928
3 SASI_Hs01_00133513 predicted 568
4 SASI_Hs01_00133514 predicted 501
5 SASI_Hs01_00133515 predicted 862
6 SASI_Hs01_00133517 predicted 786
7 SASI_Hs01_00133518 predicted 1022
8 SASI_Hs02_00367634 predicted 502
9 SASI_Hs02_00367635 predicted 1214
10 SASI_Hs02_00367636 predicted 1215
11 SASI_Hs01_00133509 predicted 382
12 SASI_Hs01_00133510 predicted 379
13 SASI_Hs01_00133516 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090644 predicted 768
2 SASI_Rn01_00090645 predicted 360
3 SASI_Rn01_00090646 predicted 730
4 SASI_Rn01_00090647 predicted 293
5 SASI_Rn01_00090648 predicted 717
6 SASI_Rn01_00090649 predicted 616
7 SASI_Rn01_00090650 predicted 358
8 SASI_Rn01_00090651 predicted 213
9 SASI_Rn01_00090652 predicted 756
10 SASI_Rn02_00269602 predicted 762
11 SASI_Rn01_00090643 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081351 predicted 214
2 SASI_Mm01_00081352 predicted 616
3 SASI_Mm01_00081353 predicted 728
4 SASI_Mm01_00081354 predicted 294
5 SASI_Mm01_00081355 predicted 654
6 SASI_Mm01_00081356 predicted 743
7 SASI_Mm02_00345522 predicted 725
8 SASI_Mm01_00081358 predicted 705
9 SASI_Mm01_00081359 predicted 482
10 SASI_Mm02_00345523 predicted 209
11 SASI_Mm01_00081350 predicted 463
12 SASI_Mm01_00081357 predicted 717
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170699
GPBAR1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled bile acid receptor 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170699.2-741s21c1
Sequence:CCGGACCTGTACCTCGAAGTCTATGCTCGAGCATAGACTTCGAGGTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170699.2-1221s21c1
Sequence:CCGGTCGACCTGGACTTGAACTAAACTCGAGTTTAGTTCAAGTCCAGGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170699.2-507s21c1
Sequence:CCGGTCGTCTACTTGGCTCCCAACTCTCGAGAGTTGGGAGCCAAGTAGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170699.1-1172s1c1
Sequence:CCGGGCATTGCCTACCACCCAAGCACTCGAGTGCTTGGGTGGTAGGCAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170699.1-309s1c1
Sequence:CCGGCCTCATCATCACCGCGAACCTCTCGAGAGGTTCGCGGTGATGATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170699.1-492s1c1
Sequence:CCGGCGTCTACTTGGCTCCCAACTTCTCGAGAAGTTGGGAGCCAAGTAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170699.1-1237s1c1
Sequence:CCGGTGCTGACTCCTACCAGAGCATCTCGAGATGCTCTGGTAGGAGTCAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170699
GPBAR1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled bile acid receptor 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170699.2-741s21c1
Sequence:CCGGACCTGTACCTCGAAGTCTATGCTCGAGCATAGACTTCGAGGTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170699.2-1221s21c1
Sequence:CCGGTCGACCTGGACTTGAACTAAACTCGAGTTTAGTTCAAGTCCAGGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170699.2-507s21c1
Sequence:CCGGTCGTCTACTTGGCTCCCAACTCTCGAGAGTTGGGAGCCAAGTAGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170699.1-1172s1c1
Sequence:CCGGGCATTGCCTACCACCCAAGCACTCGAGTGCTTGGGTGGTAGGCAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170699.1-309s1c1
Sequence:CCGGCCTCATCATCACCGCGAACCTCTCGAGAGGTTCGCGGTGATGATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170699.1-492s1c1
Sequence:CCGGCGTCTACTTGGCTCCCAACTTCTCGAGAAGTTGGGAGCCAAGTAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170699.1-1237s1c1
Sequence:CCGGTGCTGACTCCTACCAGAGCATCTCGAGATGCTCTGGTAGGAGTCAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170699
GPBAR1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled bile acid receptor 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170699.2-741s21c1
Sequence:CCGGACCTGTACCTCGAAGTCTATGCTCGAGCATAGACTTCGAGGTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170699.2-1221s21c1
Sequence:CCGGTCGACCTGGACTTGAACTAAACTCGAGTTTAGTTCAAGTCCAGGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170699.2-507s21c1
Sequence:CCGGTCGTCTACTTGGCTCCCAACTCTCGAGAGTTGGGAGCCAAGTAGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170699.1-1172s1c1
Sequence:CCGGGCATTGCCTACCACCCAAGCACTCGAGTGCTTGGGTGGTAGGCAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170699.1-309s1c1
Sequence:CCGGCCTCATCATCACCGCGAACCTCTCGAGAGGTTCGCGGTGATGATGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170699.1-492s1c1
Sequence:CCGGCGTCTACTTGGCTCCCAACTTCTCGAGAAGTTGGGAGCCAAGTAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_170699.1-1237s1c1
Sequence:CCGGTGCTGACTCCTACCAGAGCATCTCGAGATGCTCTGGTAGGAGTCAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174985
GPBAR1 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled bile acid receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-210s1c1
Sequence:CCGGGCCTGGGCTATGGAGCCGGAACTCGAGTTCCGGCTCCATAGCCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-779s1c1
Sequence:CCGGCTCTGTTATCGCTCATCTCATCTCGAGATGAGATGAGCGATAACAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-729s1c1
Sequence:CCGGGCTCCTGTCAGTCTTGGCCTACTCGAGTAGGCCAAGACTGACAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-151s1c1
Sequence:CCGGTGCTTCTTCCTAAGCCTACTACTCGAGTAGTAGGCTTAGGAAGAAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-488s1c1
Sequence:CCGGCCTACCTCTACCTGGAAGTTTCTCGAGAAACTTCCAGGTAGAGGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174985
GPBAR1 MISSION shRNA shRNA Plasmid DNA
G protein-coupled bile acid receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-210s1c1
Sequence:CCGGGCCTGGGCTATGGAGCCGGAACTCGAGTTCCGGCTCCATAGCCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-779s1c1
Sequence:CCGGCTCTGTTATCGCTCATCTCATCTCGAGATGAGATGAGCGATAACAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-729s1c1
Sequence:CCGGGCTCCTGTCAGTCTTGGCCTACTCGAGTAGGCCAAGACTGACAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-151s1c1
Sequence:CCGGTGCTTCTTCCTAAGCCTACTACTCGAGTAGTAGGCTTAGGAAGAAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-488s1c1
Sequence:CCGGCCTACCTCTACCTGGAAGTTTCTCGAGAAACTTCCAGGTAGAGGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174985
GPBAR1 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled bile acid receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-210s1c1
Sequence:CCGGGCCTGGGCTATGGAGCCGGAACTCGAGTTCCGGCTCCATAGCCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-779s1c1
Sequence:CCGGCTCTGTTATCGCTCATCTCATCTCGAGATGAGATGAGCGATAACAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-729s1c1
Sequence:CCGGGCTCCTGTCAGTCTTGGCCTACTCGAGTAGGCCAAGACTGACAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-151s1c1
Sequence:CCGGTGCTTCTTCCTAAGCCTACTACTCGAGTAGTAGGCTTAGGAAGAAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174985.1-488s1c1
Sequence:CCGGCCTACCTCTACCTGGAAGTTTCTCGAGAAACTTCCAGGTAGAGGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)