EMAIL THIS PAGE TO A FRIEND

GPBP1L1

GC-rich promoter binding protein 1-like 1

89 Gene Product Result for
Synonyms: RP11-767N6.1
UniProtKB ID: Q9HC44, D3DQ10, Q9H751
Gene ID:
Mouse(77110) GC-rich promoter binding protein 1-like 1
Rat(313519) GC-rich promoter binding protein 1-like 1
Zebrafish(799876) GC-rich promoter binding protein 1-like 1
cow(505780) GC-rich promoter binding protein 1-like 1
Horse(100052246) GC-rich promoter binding protein 1-like 1
domestic cat(101081239) GC-rich promoter binding protein 1-like 1
dog(475372) GC-rich promoter binding protein 1-like 1
chicken(424603) GC-rich promoter binding protein 1-like 1
sheep(101122478) GC-rich promoter binding protein 1-like 1
Domestic Rabbit(100346031) GC-rich promoter binding protein 1-like 1
domestic guinea pig(100734766) GC-rich promoter binding protein 1-like 1
naked mole-rat(101712994) GC-rich promoter binding protein 1-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021639 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021639 Rosetta Predictions human pricing
NM_001034913 Rosetta Predictions rat pricing
NM_029868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242368 predicted 1754
2 SASI_Hs01_00242369 predicted 1671
3 SASI_Hs01_00242370 predicted 2302
4 SASI_Hs01_00242371 predicted 1140
5 SASI_Hs02_00354999 predicted 2360
6 SASI_Hs01_00242372 predicted 1751
7 SASI_Hs01_00242373 predicted 2387
8 SASI_Hs01_00242374 predicted 1436
9 SASI_Hs01_00242375 predicted 1413
10 SASI_Hs01_00242376 predicted 1349
11 SASI_Hs01_00242377 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204050 predicted 755
2 SASI_Rn01_00066806 predicted 1108
3 SASI_Rn01_00066807 predicted 1162
4 SASI_Rn01_00066808 predicted 1815
5 SASI_Rn01_00066809 predicted 1443
6 SASI_Rn01_00066810 predicted 1018
7 SASI_Rn01_00066811 predicted 553
8 SASI_Rn01_00066812 predicted 649
9 SASI_Rn01_00066813 predicted 1334
10 SASI_Rn01_00066814 predicted 1121
11 SASI_Rn01_00066815 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179991 predicted 1595
2 SASI_Mm01_00179999 predicted 1979
3 SASI_Mm01_00179992 predicted 1380
4 SASI_Mm01_00180000 predicted 1938
5 SASI_Mm01_00179993 predicted 1303
6 SASI_Mm02_00336102 predicted 2465
7 SASI_Mm01_00179994 predicted 1462
8 SASI_Mm01_00179995 predicted 1796
9 SASI_Mm01_00179996 predicted 1462
10 SASI_Mm01_00179997 predicted 1213
11 SASI_Mm01_00179998 predicted 1478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021639
VALIDATED
GPBP1L1 MISSION shRNA Bacterial Glycerol Stock
GC-rich promoter binding protein 1-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021639.4-3031s21c1
Sequence:CCGGACACATACACACCCAGTATATCTCGAGATATACTGGGTGTGTATGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021639.4-2775s21c1
Sequence:CCGGGCCTGGAAGTAGGCATATAAACTCGAGTTTATATGCCTACTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021639.4-2021s21c1
Sequence:CCGGCCATGCAAATGGGAACAAATTCTCGAGAATTTGTTCCCATTTGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021639.4-1934s21c1
Sequence:CCGGACCCTCCAAGATGCTAGTTATCTCGAGATAACTAGCATCTTGGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021639.4-2525s21c1
Sequence:CCGGGCACAGGTTATTGAAAGCTATCTCGAGATAGCTTTCAATAACCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021639.3-2175s1c1
Sequence:CCGGGCACAGGTTATTGAAAGCTATCTCGAGATAGCTTTCAATAACCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021639.3-1671s1c1
Sequence:CCGGCCATGCAAATGGGAACAAATTCTCGAGAATTTGTTCCCATTTGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021639.3-1830s1c1
Sequence:CCGGCAGTCCAATCTCTGTTACCAACTCGAGTTGGTAACAGAGATTGGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021639.3-1587s1c1
Sequence:CCGGCTCCAAGATGCTAGTTATCAACTCGAGTTGATAACTAGCATCTTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021639.3-2808s1c1
Sequence:CCGGGCAATCATTGTCAATGACAAACTCGAGTTTGTCATTGACAATGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021639
VALIDATED
GPBP1L1 MISSION shRNA shRNA Plasmid DNA
GC-rich promoter binding protein 1-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021639.4-3031s21c1
Sequence:CCGGACACATACACACCCAGTATATCTCGAGATATACTGGGTGTGTATGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021639.4-2775s21c1
Sequence:CCGGGCCTGGAAGTAGGCATATAAACTCGAGTTTATATGCCTACTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021639.4-2021s21c1
Sequence:CCGGCCATGCAAATGGGAACAAATTCTCGAGAATTTGTTCCCATTTGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021639.4-1934s21c1
Sequence:CCGGACCCTCCAAGATGCTAGTTATCTCGAGATAACTAGCATCTTGGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021639.4-2525s21c1
Sequence:CCGGGCACAGGTTATTGAAAGCTATCTCGAGATAGCTTTCAATAACCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021639.3-2175s1c1
Sequence:CCGGGCACAGGTTATTGAAAGCTATCTCGAGATAGCTTTCAATAACCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021639.3-1671s1c1
Sequence:CCGGCCATGCAAATGGGAACAAATTCTCGAGAATTTGTTCCCATTTGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021639.3-1830s1c1
Sequence:CCGGCAGTCCAATCTCTGTTACCAACTCGAGTTGGTAACAGAGATTGGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021639.3-1587s1c1
Sequence:CCGGCTCCAAGATGCTAGTTATCAACTCGAGTTGATAACTAGCATCTTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021639.3-2808s1c1
Sequence:CCGGGCAATCATTGTCAATGACAAACTCGAGTTTGTCATTGACAATGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021639
VALIDATED
GPBP1L1 MISSION shRNA Lentiviral Transduction Particles
GC-rich promoter binding protein 1-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021639.4-3031s21c1
Sequence:CCGGACACATACACACCCAGTATATCTCGAGATATACTGGGTGTGTATGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021639.4-2775s21c1
Sequence:CCGGGCCTGGAAGTAGGCATATAAACTCGAGTTTATATGCCTACTTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021639.4-2021s21c1
Sequence:CCGGCCATGCAAATGGGAACAAATTCTCGAGAATTTGTTCCCATTTGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021639.4-1934s21c1
Sequence:CCGGACCCTCCAAGATGCTAGTTATCTCGAGATAACTAGCATCTTGGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021639.4-2525s21c1
Sequence:CCGGGCACAGGTTATTGAAAGCTATCTCGAGATAGCTTTCAATAACCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021639.3-2175s1c1
Sequence:CCGGGCACAGGTTATTGAAAGCTATCTCGAGATAGCTTTCAATAACCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021639.3-1671s1c1
Sequence:CCGGCCATGCAAATGGGAACAAATTCTCGAGAATTTGTTCCCATTTGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021639.3-1830s1c1
Sequence:CCGGCAGTCCAATCTCTGTTACCAACTCGAGTTGGTAACAGAGATTGGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021639.3-1587s1c1
Sequence:CCGGCTCCAAGATGCTAGTTATCAACTCGAGTTGATAACTAGCATCTTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183228    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021639.3-2808s1c1
Sequence:CCGGGCAATCATTGTCAATGACAAACTCGAGTTTGTCATTGACAATGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029868
GPBP1L1 MISSION shRNA Bacterial Glycerol Stock
GC-rich promoter binding protein 1-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029868.2-2147s1c1
Sequence:CCGGCTCTGAAGGATGAACGAAATGCTCGAGCATTTCGTTCATCCTTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029868.2-2326s1c1
Sequence:CCGGGAAGCAGAGCACAGGTTATTACTCGAGTAATAACCTGTGCTCTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029868.2-2763s21c1
Sequence:CCGGTTACCTGCTTAATAGGCATTTCTCGAGAAATGCCTATTAAGCAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029868.2-2326s21c1
Sequence:CCGGGAAGCAGAGCACAGGTTATTACTCGAGTAATAACCTGTGCTCTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029868.2-1347s21c1
Sequence:CCGGTCTACGGACTACGGGAGATTCCTCGAGGAATCTCCCGTAGTCCGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029868.2-1213s21c1
Sequence:CCGGTCAACGCCACAGTCATCTAAGCTCGAGCTTAGATGACTGTGGCGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029868.2-1297s21c1
Sequence:CCGGATAAGCCGTCGTCGACATAATCTCGAGATTATGTCGACGACGGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191795    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029868.2-2634s1c1
Sequence:CCGGGCCTTGTGTTTAGAGAATATACTCGAGTATATTCTCTAAACACAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029868.2-1857s1c1
Sequence:CCGGCCCAAGTGTCTATAAGAACTTCTCGAGAAGTTCTTATAGACACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029868.2-1982s1c1
Sequence:CCGGCCAATCCAATTTCTGTTACTACTCGAGTAGTAACAGAAATTGGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029868
GPBP1L1 MISSION shRNA shRNA Plasmid DNA
GC-rich promoter binding protein 1-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029868.2-2147s1c1
Sequence:CCGGCTCTGAAGGATGAACGAAATGCTCGAGCATTTCGTTCATCCTTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029868.2-2326s1c1
Sequence:CCGGGAAGCAGAGCACAGGTTATTACTCGAGTAATAACCTGTGCTCTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029868.2-2763s21c1
Sequence:CCGGTTACCTGCTTAATAGGCATTTCTCGAGAAATGCCTATTAAGCAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029868.2-2326s21c1
Sequence:CCGGGAAGCAGAGCACAGGTTATTACTCGAGTAATAACCTGTGCTCTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029868.2-1347s21c1
Sequence:CCGGTCTACGGACTACGGGAGATTCCTCGAGGAATCTCCCGTAGTCCGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029868.2-1213s21c1
Sequence:CCGGTCAACGCCACAGTCATCTAAGCTCGAGCTTAGATGACTGTGGCGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029868.2-1297s21c1
Sequence:CCGGATAAGCCGTCGTCGACATAATCTCGAGATTATGTCGACGACGGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191795    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029868.2-2634s1c1
Sequence:CCGGGCCTTGTGTTTAGAGAATATACTCGAGTATATTCTCTAAACACAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029868.2-1857s1c1
Sequence:CCGGCCCAAGTGTCTATAAGAACTTCTCGAGAAGTTCTTATAGACACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029868.2-1982s1c1
Sequence:CCGGCCAATCCAATTTCTGTTACTACTCGAGTAGTAACAGAAATTGGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029868
GPBP1L1 MISSION shRNA Lentiviral Transduction Particles
GC-rich promoter binding protein 1-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029868.2-2147s1c1
Sequence:CCGGCTCTGAAGGATGAACGAAATGCTCGAGCATTTCGTTCATCCTTCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029868.2-2326s1c1
Sequence:CCGGGAAGCAGAGCACAGGTTATTACTCGAGTAATAACCTGTGCTCTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246906    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029868.2-2763s21c1
Sequence:CCGGTTACCTGCTTAATAGGCATTTCTCGAGAAATGCCTATTAAGCAGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029868.2-2326s21c1
Sequence:CCGGGAAGCAGAGCACAGGTTATTACTCGAGTAATAACCTGTGCTCTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029868.2-1347s21c1
Sequence:CCGGTCTACGGACTACGGGAGATTCCTCGAGGAATCTCCCGTAGTCCGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029868.2-1213s21c1
Sequence:CCGGTCAACGCCACAGTCATCTAAGCTCGAGCTTAGATGACTGTGGCGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029868.2-1297s21c1
Sequence:CCGGATAAGCCGTCGTCGACATAATCTCGAGATTATGTCGACGACGGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191795    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029868.2-2634s1c1
Sequence:CCGGGCCTTGTGTTTAGAGAATATACTCGAGTATATTCTCTAAACACAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191345    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029868.2-1857s1c1
Sequence:CCGGCCCAAGTGTCTATAAGAACTTCTCGAGAAGTTCTTATAGACACTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029868.2-1982s1c1
Sequence:CCGGCCAATCCAATTTCTGTTACTACTCGAGTAGTAACAGAAATTGGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)