EMAIL THIS PAGE TO A FRIEND

GPR156

G protein-coupled receptor 156

53 Gene Product Result for
Synonyms: GABABL PGR28
UniProtKB ID: Q8NFN8, B7ZL66, E9PFZ4, Q14CM1, Q86SN6
Gene ID:
Human(165829) Summary: G protein-coupled receptors (GPCRs) are a large superfamily of cell surface receptors characterized by 7 helical transmembrane domains, together with N-terminal extracellular and C-terminal intracellular domains.[supplied by OMIM, Mar 2008]
Mouse(239845) G protein-coupled receptor 156
Rat(260430) G protein-coupled receptor 156
chicken(418333) G protein-coupled receptor 156
cow(539186) G protein-coupled receptor 156
Horse(100070872) G protein-coupled receptor 156
domestic cat(101082085) G protein-coupled receptor 156
dog(488000) G protein-coupled receptor 156
sheep(101107652) G protein-coupled receptor 156
Domestic Rabbit(100347835) G protein-coupled receptor 156
domestic guinea pig(100714847) G protein-coupled receptor 156
naked mole-rat(101700687) G protein-coupled receptor 156
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153002 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153002 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153002 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153002 Rosetta Predictions human pricing
NM_153295 Rosetta Predictions rat pricing
NM_153394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153002 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136506 predicted 587
2 SASI_Hs01_00136507 predicted 649
3 SASI_Hs01_00136509 predicted 635
4 SASI_Hs02_00366962 predicted 1097
5 SASI_Hs01_00136510 predicted 753
6 SASI_Hs01_00136511 predicted 533
7 SASI_Hs01_00136512 predicted 513
8 SASI_Hs02_00366963 predicted 2201
9 SASI_Hs01_00136513 predicted 898
10 SASI_Hs01_00136514 predicted 269
11 SASI_Hs01_00136508 predicted 357
12 SASI_Hs01_00136515 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039689 predicted 458
2 SASI_Rn01_00039690 predicted 1827
3 SASI_Rn02_00268940 predicted 450
4 SASI_Rn01_00039692 predicted 345
5 SASI_Rn01_00039693 predicted 1576
6 SASI_Rn01_00039694 predicted 611
7 SASI_Rn01_00039695 predicted 469
8 SASI_Rn01_00039696 predicted 1719
9 SASI_Rn01_00039697 predicted 264
10 SASI_Rn01_00039698 predicted 638
11 SASI_Rn01_00039691 predicted 1582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139673 predicted 820
2 SASI_Mm01_00139674 predicted 1967
3 SASI_Mm01_00139675 predicted 1381
4 SASI_Mm01_00139676 predicted 2293
5 SASI_Mm01_00139677 predicted 927
6 SASI_Mm01_00139679 predicted 1328
7 SASI_Mm01_00139680 predicted 1380
8 SASI_Mm01_00139681 predicted 764
9 SASI_Mm01_00139682 predicted 1107
10 SASI_Mm02_00343173 predicted 996
11 SASI_Mm01_00139678 predicted 676
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153002
GPR156 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 156
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-754s1c1
Sequence:CCGGCCTCCTGTGAATCAGTCCTTACTCGAGTAAGGACTGATTCACAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-1955s1c1
Sequence:CCGGCCAGAGTACGAAGACCTTCTTCTCGAGAAGAAGGTCTTCGTACTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-663s1c1
Sequence:CCGGCGATGTTTGGATTGCTCTCATCTCGAGATGAGAGCAATCCAAACATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-1614s1c1
Sequence:CCGGGTCACGGGTTAGTTCAGTAATCTCGAGATTACTGAACTAACCCGTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-139s1c1
Sequence:CCGGCCTGTCCTCTTGGGTATTGTTCTCGAGAACAATACCCAAGAGGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153002.1-428s21c1
Sequence:CCGGGGCGACTCTACAAGGTGTTTACTCGAGTAAACACCTTGTAGAGTCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153002.1-651s21c1
Sequence:CCGGTTCCCGGTATTCCGATGTTTGCTCGAGCAAACATCGGAATACCGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153002.1-459s21c1
Sequence:CCGGCCCGGACAAGAGAGTGATTATCTCGAGATAATCACTCTCTTGTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153002
GPR156 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 156
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-754s1c1
Sequence:CCGGCCTCCTGTGAATCAGTCCTTACTCGAGTAAGGACTGATTCACAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-1955s1c1
Sequence:CCGGCCAGAGTACGAAGACCTTCTTCTCGAGAAGAAGGTCTTCGTACTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-663s1c1
Sequence:CCGGCGATGTTTGGATTGCTCTCATCTCGAGATGAGAGCAATCCAAACATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-1614s1c1
Sequence:CCGGGTCACGGGTTAGTTCAGTAATCTCGAGATTACTGAACTAACCCGTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-139s1c1
Sequence:CCGGCCTGTCCTCTTGGGTATTGTTCTCGAGAACAATACCCAAGAGGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153002.1-428s21c1
Sequence:CCGGGGCGACTCTACAAGGTGTTTACTCGAGTAAACACCTTGTAGAGTCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153002.1-651s21c1
Sequence:CCGGTTCCCGGTATTCCGATGTTTGCTCGAGCAAACATCGGAATACCGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153002.1-459s21c1
Sequence:CCGGCCCGGACAAGAGAGTGATTATCTCGAGATAATCACTCTCTTGTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153002
GPR156 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 156
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-754s1c1
Sequence:CCGGCCTCCTGTGAATCAGTCCTTACTCGAGTAAGGACTGATTCACAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-1955s1c1
Sequence:CCGGCCAGAGTACGAAGACCTTCTTCTCGAGAAGAAGGTCTTCGTACTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-663s1c1
Sequence:CCGGCGATGTTTGGATTGCTCTCATCTCGAGATGAGAGCAATCCAAACATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-1614s1c1
Sequence:CCGGGTCACGGGTTAGTTCAGTAATCTCGAGATTACTGAACTAACCCGTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153002.1-139s1c1
Sequence:CCGGCCTGTCCTCTTGGGTATTGTTCTCGAGAACAATACCCAAGAGGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153002.1-428s21c1
Sequence:CCGGGGCGACTCTACAAGGTGTTTACTCGAGTAAACACCTTGTAGAGTCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153002.1-651s21c1
Sequence:CCGGTTCCCGGTATTCCGATGTTTGCTCGAGCAAACATCGGAATACCGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153002.1-459s21c1
Sequence:CCGGCCCGGACAAGAGAGTGATTATCTCGAGATAATCACTCTCTTGTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153394
GPR156 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 156
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153394.2-2305s1c1
Sequence:CCGGGTACCGTTTCTAGTTCACAAACTCGAGTTTGTGAACTAGAAACGGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153394.2-2495s1c1
Sequence:CCGGCGGAGCATGCAATGTAGCTTTCTCGAGAAAGCTACATTGCATGCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153394.2-2829s1c1
Sequence:CCGGCCTGTTGTGAACTTCAAAGATCTCGAGATCTTTGAAGTTCACAACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153394.2-1367s1c1
Sequence:CCGGCGTTTGCACAACCACTGTGAACTCGAGTTCACAGTGGTTGTGCAAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153394.2-4152s1c1
Sequence:CCGGCCAAGTTCTTTACCACCACTTCTCGAGAAGTGGTGGTAAAGAACTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153394
GPR156 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 156
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153394.2-2305s1c1
Sequence:CCGGGTACCGTTTCTAGTTCACAAACTCGAGTTTGTGAACTAGAAACGGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153394.2-2495s1c1
Sequence:CCGGCGGAGCATGCAATGTAGCTTTCTCGAGAAAGCTACATTGCATGCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153394.2-2829s1c1
Sequence:CCGGCCTGTTGTGAACTTCAAAGATCTCGAGATCTTTGAAGTTCACAACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153394.2-1367s1c1
Sequence:CCGGCGTTTGCACAACCACTGTGAACTCGAGTTCACAGTGGTTGTGCAAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153394.2-4152s1c1
Sequence:CCGGCCAAGTTCTTTACCACCACTTCTCGAGAAGTGGTGGTAAAGAACTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153394
GPR156 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 156
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153394.2-2305s1c1
Sequence:CCGGGTACCGTTTCTAGTTCACAAACTCGAGTTTGTGAACTAGAAACGGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153394.2-2495s1c1
Sequence:CCGGCGGAGCATGCAATGTAGCTTTCTCGAGAAAGCTACATTGCATGCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153394.2-2829s1c1
Sequence:CCGGCCTGTTGTGAACTTCAAAGATCTCGAGATCTTTGAAGTTCACAACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153394.2-1367s1c1
Sequence:CCGGCGTTTGCACAACCACTGTGAACTCGAGTTCACAGTGGTTGTGCAAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027545    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153394.2-4152s1c1
Sequence:CCGGCCAAGTTCTTTACCACCACTTCTCGAGAAGTGGTGGTAAAGAACTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)