EMAIL THIS PAGE TO A FRIEND

GPR182

G protein-coupled receptor 182

52 Gene Product Result for
Synonyms: 7TMR ADMR AM-R AMR G10D gamrh hrhAMR
UniProtKB ID: O15218
Gene ID:
Human(11318) Summary: Adrenomedullin is a potent vasodilator peptide that exerts major effects on cardiovascular function. This gene encodes a seven-transmembrane protein that belongs to the family 1 of G-protein coupled receptors. Studies of the rat counterpart suggest that the encoded protein may function as a receptor for adrenomedullin. [provided by RefSeq, Jul 2008]
Mouse(11536) G protein-coupled receptor 182
Rat(29307) G protein-coupled receptor 182
Zebrafish(323641) G protein-coupled receptor 182
chicken(100858910) G protein-coupled receptor 182
cow(509554) G protein-coupled receptor 182
domestic cat(101080809) G protein-coupled receptor 182
dog(481120) G protein-coupled receptor 182
domestic guinea pig(100716107) G protein-coupled receptor 182
naked mole-rat(101697797) G protein-coupled receptor 182
sheep(101103963) G protein-coupled receptor 182
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007264 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007264 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007264 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007264 Rosetta Predictions human pricing
NM_053302 Rosetta Predictions rat pricing
NM_007412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007264 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224905 predicted 1000
2 SASI_Hs01_00224906 predicted 263
3 SASI_Hs01_00224908 predicted 1234
4 SASI_Hs01_00224909 predicted 1125
5 SASI_Hs01_00224910 predicted 1317
6 SASI_Hs01_00224911 predicted 403
7 SASI_Hs02_00343298 predicted 778
8 SASI_Hs01_00224912 predicted 1293
9 SASI_Hs01_00224913 predicted 869
10 SASI_Hs01_00224914 predicted 938
11 SASI_Hs01_00224907 predicted 1253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058854 predicted 1016
2 SASI_Rn01_00058855 predicted 518
3 SASI_Rn01_00058856 predicted 588
4 SASI_Rn01_00058857 predicted 290
5 SASI_Rn01_00058858 predicted 834
6 SASI_Rn01_00058859 predicted 261
7 SASI_Rn02_00265694 predicted 1353
8 SASI_Rn01_00058861 predicted 344
9 SASI_Rn01_00058862 predicted 1136
10 SASI_Rn01_00058863 predicted 358
11 SASI_Rn01_00058860 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090579 predicted 970
2 SASI_Mm01_00090580 predicted 387
3 SASI_Mm01_00090581 predicted 577
4 SASI_Mm01_00090582 predicted 650
5 SASI_Mm01_00090583 predicted 1088
6 SASI_Mm01_00090584 predicted 1425
7 SASI_Mm01_00090585 predicted 985
8 SASI_Mm01_00090586 predicted 1078
9 SASI_Mm02_00311556 predicted 242
10 SASI_Mm01_00090587 predicted 522
11 SASI_Mm01_00090588 predicted 390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007264
GPR182 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 182
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007264.3-1087s21c1
Sequence:CCGGCCTGAATGCTGTAGTCCATTACTCGAGTAATGGACTACAGCATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007264.3-1237s21c1
Sequence:CCGGGAGCTTTCAGGCACACCATTTCTCGAGAAATGGTGTGCCTGAAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007264.3-489s21c1
Sequence:CCGGTCTACTTTGTCAACATGTATACTCGAGTATACATGTTGACAAAGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007264.3-1396s21c1
Sequence:CCGGTCAAAGCACTCGTGGTCAATTCTCGAGAATTGACCACGAGTGCTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007264.2-484s1c1
Sequence:CCGGCTACTTCTACTTTGTCAACATCTCGAGATGTTGACAAAGTAGAAGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007264.2-1095s1c1
Sequence:CCGGCTGTAGTCCATTACCTTCCTACTCGAGTAGGAAGGTAATGGACTACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007264.2-475s1c1
Sequence:CCGGCTTCACTCACTACTTCTACTTCTCGAGAAGTAGAAGTAGTGAGTGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007264.2-788s1c1
Sequence:CCGGCCTCTCATCACAGTCTTCAATCTCGAGATTGAAGACTGTGATGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007264
GPR182 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 182
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007264.3-1087s21c1
Sequence:CCGGCCTGAATGCTGTAGTCCATTACTCGAGTAATGGACTACAGCATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007264.3-1237s21c1
Sequence:CCGGGAGCTTTCAGGCACACCATTTCTCGAGAAATGGTGTGCCTGAAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007264.3-489s21c1
Sequence:CCGGTCTACTTTGTCAACATGTATACTCGAGTATACATGTTGACAAAGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007264.3-1396s21c1
Sequence:CCGGTCAAAGCACTCGTGGTCAATTCTCGAGAATTGACCACGAGTGCTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007264.2-484s1c1
Sequence:CCGGCTACTTCTACTTTGTCAACATCTCGAGATGTTGACAAAGTAGAAGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007264.2-1095s1c1
Sequence:CCGGCTGTAGTCCATTACCTTCCTACTCGAGTAGGAAGGTAATGGACTACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007264.2-475s1c1
Sequence:CCGGCTTCACTCACTACTTCTACTTCTCGAGAAGTAGAAGTAGTGAGTGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007264.2-788s1c1
Sequence:CCGGCCTCTCATCACAGTCTTCAATCTCGAGATTGAAGACTGTGATGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007264
GPR182 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 182
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007264.3-1087s21c1
Sequence:CCGGCCTGAATGCTGTAGTCCATTACTCGAGTAATGGACTACAGCATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007264.3-1237s21c1
Sequence:CCGGGAGCTTTCAGGCACACCATTTCTCGAGAAATGGTGTGCCTGAAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007264.3-489s21c1
Sequence:CCGGTCTACTTTGTCAACATGTATACTCGAGTATACATGTTGACAAAGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356596    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007264.3-1396s21c1
Sequence:CCGGTCAAAGCACTCGTGGTCAATTCTCGAGAATTGACCACGAGTGCTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007264.2-484s1c1
Sequence:CCGGCTACTTCTACTTTGTCAACATCTCGAGATGTTGACAAAGTAGAAGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007264.2-1095s1c1
Sequence:CCGGCTGTAGTCCATTACCTTCCTACTCGAGTAGGAAGGTAATGGACTACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007264.2-475s1c1
Sequence:CCGGCTTCACTCACTACTTCTACTTCTCGAGAAGTAGAAGTAGTGAGTGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007264.2-788s1c1
Sequence:CCGGCCTCTCATCACAGTCTTCAATCTCGAGATTGAAGACTGTGATGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007412
GPR182 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 182
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007412.2-409s21c1
Sequence:CCGGTAGAGAACGTCCTGGTGATATCTCGAGATATCACCAGGACGTTCTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007412.2-304s21c1
Sequence:CCGGACCTCTTCAACCAGACCTTTACTCGAGTAAAGGTCTGGTTGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007412.2-1492s21c1
Sequence:CCGGGGCTTGTTCAGGGCCAATTTACTCGAGTAAATTGGCCCTGAACAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007412.2-251s21c1
Sequence:CCGGCTTGGAACCGGACAATGATTTCTCGAGAAATCATTGTCCGGTTCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007412.2-1379s21c1
Sequence:CCGGCTCACCTACACTCTGCAATTCCTCGAGGAATTGCAGAGTGTAGGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-878s1c1
Sequence:CCGGGTGGGCTTACATAGTTGTCTTCTCGAGAAGACAACTATGTAAGCCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-801s1c1
Sequence:CCGGGCAGTGTTCAATATCCTGACACTCGAGTGTCAGGATATTGAACACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-472s1c1
Sequence:CCGGCCTGTCGCTTCATTCATTATTCTCGAGAATAATGAATGAAGCGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-221s1c1
Sequence:CCGGCGATTGCCACATAGAATTCAACTCGAGTTGAATTCTATGTGGCAATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-282s1c1
Sequence:CCGGGCCATCTTCGTGGTAGGCTTACTCGAGTAAGCCTACCACGAAGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007412
GPR182 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 182
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007412.2-409s21c1
Sequence:CCGGTAGAGAACGTCCTGGTGATATCTCGAGATATCACCAGGACGTTCTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007412.2-304s21c1
Sequence:CCGGACCTCTTCAACCAGACCTTTACTCGAGTAAAGGTCTGGTTGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007412.2-1492s21c1
Sequence:CCGGGGCTTGTTCAGGGCCAATTTACTCGAGTAAATTGGCCCTGAACAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007412.2-251s21c1
Sequence:CCGGCTTGGAACCGGACAATGATTTCTCGAGAAATCATTGTCCGGTTCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007412.2-1379s21c1
Sequence:CCGGCTCACCTACACTCTGCAATTCCTCGAGGAATTGCAGAGTGTAGGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-878s1c1
Sequence:CCGGGTGGGCTTACATAGTTGTCTTCTCGAGAAGACAACTATGTAAGCCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-801s1c1
Sequence:CCGGGCAGTGTTCAATATCCTGACACTCGAGTGTCAGGATATTGAACACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-472s1c1
Sequence:CCGGCCTGTCGCTTCATTCATTATTCTCGAGAATAATGAATGAAGCGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-221s1c1
Sequence:CCGGCGATTGCCACATAGAATTCAACTCGAGTTGAATTCTATGTGGCAATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-282s1c1
Sequence:CCGGGCCATCTTCGTGGTAGGCTTACTCGAGTAAGCCTACCACGAAGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007412
GPR182 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 182
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007412.2-409s21c1
Sequence:CCGGTAGAGAACGTCCTGGTGATATCTCGAGATATCACCAGGACGTTCTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007412.2-304s21c1
Sequence:CCGGACCTCTTCAACCAGACCTTTACTCGAGTAAAGGTCTGGTTGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007412.2-1492s21c1
Sequence:CCGGGGCTTGTTCAGGGCCAATTTACTCGAGTAAATTGGCCCTGAACAAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007412.2-251s21c1
Sequence:CCGGCTTGGAACCGGACAATGATTTCTCGAGAAATCATTGTCCGGTTCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007412.2-1379s21c1
Sequence:CCGGCTCACCTACACTCTGCAATTCCTCGAGGAATTGCAGAGTGTAGGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-878s1c1
Sequence:CCGGGTGGGCTTACATAGTTGTCTTCTCGAGAAGACAACTATGTAAGCCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-801s1c1
Sequence:CCGGGCAGTGTTCAATATCCTGACACTCGAGTGTCAGGATATTGAACACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-472s1c1
Sequence:CCGGCCTGTCGCTTCATTCATTATTCTCGAGAATAATGAATGAAGCGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-221s1c1
Sequence:CCGGCGATTGCCACATAGAATTCAACTCGAGTTGAATTCTATGTGGCAATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007412.1-282s1c1
Sequence:CCGGGCCATCTTCGTGGTAGGCTTACTCGAGTAAGCCTACCACGAAGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)