EMAIL THIS PAGE TO A FRIEND

GPR44

14 Gene Product Result for
Gene ID:
dog(483805) G protein-coupled receptor 44
cow(337885) G protein-coupled receptor 44
domestic guinea pig(100379270) G protein-coupled receptor 44
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009962 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009962 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009962 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU040841 MISSION® esiRNA esiRNA targeting mouse Gpr44 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_009962 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317528 predicted 1882
2 SASI_Mm01_00051021 predicted 1486
3 SASI_Mm01_00051022 predicted 893
4 SASI_Mm01_00051024 predicted 1765
5 SASI_Mm01_00051025 predicted 1460
6 SASI_Mm01_00051026 predicted 1599
7 SASI_Mm01_00051027 predicted 1681
8 SASI_Mm01_00051028 predicted 1638
9 SASI_Mm01_00051029 predicted 1778
10 SASI_Mm01_00051030 predicted 1576
11 SASI_Mm01_00051023 predicted 399
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009962
GPR44 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-565s1c1
Sequence:CCGGGCTACATTCCTCGGTCTTCTTCTCGAGAAGAAGACCGAGGAATGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-466s1c1
Sequence:CCGGCCTGGCGCTATCCGACTTGTTCTCGAGAACAAGTCGGATAGCGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-1152s1c1
Sequence:CCGGCACTGCTCTATGTGTTCACATCTCGAGATGTGAACACATAGAGCAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-1129s1c1
Sequence:CCGGCTTCTTCAACAGCGTGGTCAACTCGAGTTGACCACGCTGTTGAAGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-730s1c1
Sequence:CCGGGCTCAACACAATACCATATTTCTCGAGAAATATGGTATTGTGTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009962
GPR44 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-565s1c1
Sequence:CCGGGCTACATTCCTCGGTCTTCTTCTCGAGAAGAAGACCGAGGAATGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-466s1c1
Sequence:CCGGCCTGGCGCTATCCGACTTGTTCTCGAGAACAAGTCGGATAGCGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-1152s1c1
Sequence:CCGGCACTGCTCTATGTGTTCACATCTCGAGATGTGAACACATAGAGCAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-1129s1c1
Sequence:CCGGCTTCTTCAACAGCGTGGTCAACTCGAGTTGACCACGCTGTTGAAGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-730s1c1
Sequence:CCGGGCTCAACACAATACCATATTTCTCGAGAAATATGGTATTGTGTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009962
GPR44 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-565s1c1
Sequence:CCGGGCTACATTCCTCGGTCTTCTTCTCGAGAAGAAGACCGAGGAATGTAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-466s1c1
Sequence:CCGGCCTGGCGCTATCCGACTTGTTCTCGAGAACAAGTCGGATAGCGCCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-1152s1c1
Sequence:CCGGCACTGCTCTATGTGTTCACATCTCGAGATGTGAACACATAGAGCAGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-1129s1c1
Sequence:CCGGCTTCTTCAACAGCGTGGTCAACTCGAGTTGACCACGCTGTTGAAGAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009962.2-730s1c1
Sequence:CCGGGCTCAACACAATACCATATTTCTCGAGAAATATGGTATTGTGTTGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)