EMAIL THIS PAGE TO A FRIEND

GPR81

25 Gene Product Result for
Gene ID:
Rat(689936) G protein-coupled receptor 81
dog(486252) G protein-coupled receptor 81
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175520 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175520 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175520 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001072594 Rosetta Predictions rat pricing
NM_175520 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339818 predicted 723
2 SASI_Rn02_00339819 predicted 695
3 SASI_Rn02_00339820 predicted 507
4 SASI_Rn02_00339821 predicted 240
5 SASI_Rn02_00339822 predicted 627
6 SASI_Rn02_00339823 predicted 704
7 SASI_Rn02_00339824 predicted 414
8 SASI_Rn02_00339825 predicted 236
9 SASI_Rn02_00339826 predicted 627
10 SASI_Rn02_00339827 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046667 predicted 833
2 SASI_Mm01_00046668 predicted 1517
3 SASI_Mm01_00046669 predicted 1420
4 SASI_Mm02_00346452 predicted 1534
5 SASI_Mm01_00046670 predicted 1477
6 SASI_Mm01_00046671 predicted 1424
7 SASI_Mm01_00046672 predicted 1223
8 SASI_Mm01_00046673 predicted 1080
9 SASI_Mm01_00046674 predicted 761
10 SASI_Mm01_00046676 predicted 1518
11 SASI_Mm01_00046675 predicted 1541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175520
GPR81 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-1227s1c1
Sequence:CCGGCCCTTGTATATTACTTCTCAACTCGAGTTGAGAAGTAATATACAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-976s1c1
Sequence:CCGGCATCTTGTTCTGCTCGGTCAACTCGAGTTGACCGAGCAGAACAAGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-540s1c1
Sequence:CCGGCCTGGAAGTCAAGCACTATTTCTCGAGAAATAGTGCTTGACTTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-731s1c1
Sequence:CCGGGCTGTGGATAGGTATTTCAAACTCGAGTTTGAAATACCTATCCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-817s1c1
Sequence:CCGGCCTCTGGACTTTGGTCATCTTCTCGAGAAGATGACCAAAGTCCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175520
GPR81 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-1227s1c1
Sequence:CCGGCCCTTGTATATTACTTCTCAACTCGAGTTGAGAAGTAATATACAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-976s1c1
Sequence:CCGGCATCTTGTTCTGCTCGGTCAACTCGAGTTGACCGAGCAGAACAAGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-540s1c1
Sequence:CCGGCCTGGAAGTCAAGCACTATTTCTCGAGAAATAGTGCTTGACTTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-731s1c1
Sequence:CCGGGCTGTGGATAGGTATTTCAAACTCGAGTTTGAAATACCTATCCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-817s1c1
Sequence:CCGGCCTCTGGACTTTGGTCATCTTCTCGAGAAGATGACCAAAGTCCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175520
GPR81 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-1227s1c1
Sequence:CCGGCCCTTGTATATTACTTCTCAACTCGAGTTGAGAAGTAATATACAAGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-976s1c1
Sequence:CCGGCATCTTGTTCTGCTCGGTCAACTCGAGTTGACCGAGCAGAACAAGATGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-540s1c1
Sequence:CCGGCCTGGAAGTCAAGCACTATTTCTCGAGAAATAGTGCTTGACTTCCAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-731s1c1
Sequence:CCGGGCTGTGGATAGGTATTTCAAACTCGAGTTTGAAATACCTATCCACAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000027425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175520.2-817s1c1
Sequence:CCGGCCTCTGGACTTTGGTCATCTTCTCGAGAAGATGACCAAAGTCCAGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???