EMAIL THIS PAGE TO A FRIEND

GPR84

G protein-coupled receptor 84

66 Gene Product Result for
Synonyms: EX33 GPCR4
UniProtKB ID: Q9NQS5, B6V9G7
Gene ID:
Mouse(80910) G protein-coupled receptor 84
Rat(688730) G protein-coupled receptor 84
Zebrafish(100126017) G protein-coupled receptor 84
cow(540044) G protein-coupled receptor 84
Horse(100062469) G protein-coupled receptor 84
domestic cat(101093030) G protein-coupled receptor 84
dog(100687941) G protein-coupled receptor 84
domestic guinea pig(100723478) G protein-coupled receptor 84
naked mole-rat(101712992) G protein-coupled receptor 84
sheep(101119970) G protein-coupled receptor 84
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020370 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057141 MISSION® esiRNA esiRNA human GPR84 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020370 Rosetta Predictions human pricing
NM_001109509 Rosetta Predictions rat pricing
NM_030720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353324 predicted 1209
2 SASI_Hs01_00136167 predicted 1212
3 SASI_Hs01_00136168 predicted 999
4 SASI_Hs01_00136169 predicted 439
5 SASI_Hs01_00136171 predicted 999
6 SASI_Hs01_00136172 predicted 608
7 SASI_Hs01_00136173 predicted 986
8 SASI_Hs01_00136174 predicted 970
9 SASI_Hs01_00136175 predicted 892
10 SASI_Hs01_00136176 predicted 804
11 SASI_Hs01_00136170 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109509 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249099 predicted 1243
2 SASI_Rn02_00249100 predicted 1106
3 SASI_Rn02_00249101 predicted 1065
4 SASI_Rn02_00249102 predicted 959
5 SASI_Rn02_00249103 predicted 256
6 SASI_Rn02_00249104 predicted 636
7 SASI_Rn02_00249105 predicted 1231
8 SASI_Rn02_00249106 predicted 328
9 SASI_Rn02_00249107 predicted 601
10 SASI_Rn02_00249108 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078545 predicted 1298
2 SASI_Mm01_00078546 predicted 1301
3 SASI_Mm01_00078547 predicted 1252
4 SASI_Mm01_00078548 predicted 432
5 SASI_Mm01_00078549 predicted 1081
6 SASI_Mm01_00078550 predicted 975
7 SASI_Mm01_00078551 predicted 311
8 SASI_Mm01_00078552 predicted 621
9 SASI_Mm01_00078553 predicted 656
10 SASI_Mm01_00078554 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030720
GPR84 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 84
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000028183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030720.1-1420s1c1
Sequence:CCGGCCTTGGGTATTTCACAGACAACTCGAGTTGTCTGTGAAATACCCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030720.1-1137s1c1
Sequence:CCGGCCCTTCCTGTTGCTCAACATTCTCGAGAATGTTGAGCAACAGGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030720.1-190s1c1
Sequence:CCGGGCTATCGATACTTTGCAATTACTCGAGTAATTGCAAAGTATCGATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030720.1-403s1c1
Sequence:CCGGGCGCGGTCTTCTGTAGAATATCTCGAGATATTCTACAGAAGACCGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030720
GPR84 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 84
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000028183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030720.1-1420s1c1
Sequence:CCGGCCTTGGGTATTTCACAGACAACTCGAGTTGTCTGTGAAATACCCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030720.1-1137s1c1
Sequence:CCGGCCCTTCCTGTTGCTCAACATTCTCGAGAATGTTGAGCAACAGGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030720.1-190s1c1
Sequence:CCGGGCTATCGATACTTTGCAATTACTCGAGTAATTGCAAAGTATCGATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030720.1-403s1c1
Sequence:CCGGGCGCGGTCTTCTGTAGAATATCTCGAGATATTCTACAGAAGACCGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030720
GPR84 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 84
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000028183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030720.1-1420s1c1
Sequence:CCGGCCTTGGGTATTTCACAGACAACTCGAGTTGTCTGTGAAATACCCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030720.1-1137s1c1
Sequence:CCGGCCCTTCCTGTTGCTCAACATTCTCGAGAATGTTGAGCAACAGGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030720.1-190s1c1
Sequence:CCGGGCTATCGATACTTTGCAATTACTCGAGTAATTGCAAAGTATCGATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030720.1-403s1c1
Sequence:CCGGGCGCGGTCTTCTGTAGAATATCTCGAGATATTCTACAGAAGACCGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020370
GPR84 MISSION shRNA Bacterial Glycerol Stock
G protein-coupled receptor 84
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020370.1-1286s1c1
Sequence:CCGGGTGACCCTAGTCACCAGAATTCTCGAGAATTCTGGTGACTAGGGTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020370.1-1260s1c1
Sequence:CCGGGAGTTTCCATAGGCTCCATTACTCGAGTAATGGAGCCTATGGAAACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020370.1-1090s1c1
Sequence:CCGGCCCTTCTTGCTGCTCAACATTCTCGAGAATGTTGAGCAGCAAGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020370.1-937s1c1
Sequence:CCGGGCTAAGCAGATGGCAGAGAAACTCGAGTTTCTCTGCCATCTGCTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020370.1-1012s21c1
Sequence:CCGGCCGGATTCTTCATCGGAATTTCTCGAGAAATTCCGATGAAGAATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020370.1-358s21c1
Sequence:CCGGGCCACCTTCTGCAGGGTATTTCTCGAGAAATACCCTGCAGAAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020370.1-1325s21c1
Sequence:CCGGGACCAAAGTGGCCAGGTAATACTCGAGTATTACCTGGCCACTTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020370.1-976s21c1
Sequence:CCGGGCCAAAGCCCAGCCAATTAAACTCGAGTTTAATTGGCTGGGCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020370
GPR84 MISSION shRNA shRNA Plasmid DNA
G protein-coupled receptor 84
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020370.1-1286s1c1
Sequence:CCGGGTGACCCTAGTCACCAGAATTCTCGAGAATTCTGGTGACTAGGGTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020370.1-1260s1c1
Sequence:CCGGGAGTTTCCATAGGCTCCATTACTCGAGTAATGGAGCCTATGGAAACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020370.1-1090s1c1
Sequence:CCGGCCCTTCTTGCTGCTCAACATTCTCGAGAATGTTGAGCAGCAAGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020370.1-937s1c1
Sequence:CCGGGCTAAGCAGATGGCAGAGAAACTCGAGTTTCTCTGCCATCTGCTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020370.1-1012s21c1
Sequence:CCGGCCGGATTCTTCATCGGAATTTCTCGAGAAATTCCGATGAAGAATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020370.1-358s21c1
Sequence:CCGGGCCACCTTCTGCAGGGTATTTCTCGAGAAATACCCTGCAGAAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020370.1-1325s21c1
Sequence:CCGGGACCAAAGTGGCCAGGTAATACTCGAGTATTACCTGGCCACTTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020370.1-976s21c1
Sequence:CCGGGCCAAAGCCCAGCCAATTAAACTCGAGTTTAATTGGCTGGGCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020370
GPR84 MISSION shRNA Lentiviral Transduction Particles
G protein-coupled receptor 84
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020370.1-1286s1c1
Sequence:CCGGGTGACCCTAGTCACCAGAATTCTCGAGAATTCTGGTGACTAGGGTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020370.1-1260s1c1
Sequence:CCGGGAGTTTCCATAGGCTCCATTACTCGAGTAATGGAGCCTATGGAAACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020370.1-1090s1c1
Sequence:CCGGCCCTTCTTGCTGCTCAACATTCTCGAGAATGTTGAGCAGCAAGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020370.1-937s1c1
Sequence:CCGGGCTAAGCAGATGGCAGAGAAACTCGAGTTTCTCTGCCATCTGCTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020370.1-1012s21c1
Sequence:CCGGCCGGATTCTTCATCGGAATTTCTCGAGAAATTCCGATGAAGAATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020370.1-358s21c1
Sequence:CCGGGCCACCTTCTGCAGGGTATTTCTCGAGAAATACCCTGCAGAAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020370.1-1325s21c1
Sequence:CCGGGACCAAAGTGGCCAGGTAATACTCGAGTATTACCTGGCCACTTTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020370.1-976s21c1
Sequence:CCGGGCCAAAGCCCAGCCAATTAAACTCGAGTTTAATTGGCTGGGCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)