EMAIL THIS PAGE TO A FRIEND

GPRIN2

G protein regulated inducer of neurite outgrowth 2

69 Gene Product Result for
Synonyms: GRIN2 KIAA0514
UniProtKB ID: O60269, Q5SVF0
Gene ID:
Mouse(432839) G protein regulated inducer of neurite outgrowth 2
Rat(306284) G protein regulated inducer of neurite outgrowth 2
domestic guinea pig(100723903) G protein regulated inducer of neurite outgrowth 2
naked mole-rat(101715484) G protein regulated inducer of neurite outgrowth 2
sheep(101115601) G protein regulated inducer of neurite outgrowth 2
chicken(395648) G protein regulated inducer of neurite outgrowth 2
dog(489081) G protein regulated inducer of neurite outgrowth 2
domestic cat(101086506) G protein regulated inducer of neurite outgrowth 2
cow(540175) G protein regulated inducer of neurite outgrowth 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014696 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014696 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014696 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_138975 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_138975 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_138975 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135701 MISSION® esiRNA esiRNA human GPRIN2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014696 Rosetta Predictions human pricing
XM_001059778 Rosetta Predictions rat pricing
XM_224702 Rosetta Predictions rat pricing
XM_138975 Rosetta Predictions mouse pricing
XM_910756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011146 predicted 1293
2 SASI_Hs02_00346092 predicted 1206
3 SASI_Hs01_00011147 predicted 666
4 SASI_Hs01_00011148 predicted 491
5 SASI_Hs02_00346093 predicted 659
6 SASI_Hs01_00011149 predicted 1211
7 SASI_Hs01_00011151 predicted 472
8 SASI_Hs01_00011152 predicted 951
9 SASI_Hs01_00011153 predicted 1290
10 SASI_Hs02_00346094 predicted 1415
11 SASI_Hs01_00011150 predicted 833
12 SASI_Hs01_00011154 predicted 526
13 SASI_Hs01_00011155 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294310 predicted 623
2 SASI_Rn02_00294311 predicted 1325
3 SASI_Rn02_00294312 predicted 1027
4 SASI_Rn02_00294313 predicted 1330
5 SASI_Rn02_00294314 predicted 1218
6 SASI_Rn02_00294315 predicted 790
7 SASI_Rn02_00294316 predicted 570
8 SASI_Rn02_00294317 predicted 373
9 SASI_Rn02_00294318 predicted 685
10 SASI_Rn02_00294319 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382194 predicted 355
2 SASI_Rn02_00382195 predicted 1059
3 SASI_Rn02_00382196 predicted 760
4 SASI_Rn02_00382197 predicted 1061
5 SASI_Rn02_00382198 predicted 956
6 SASI_Rn02_00382199 predicted 524
7 SASI_Rn02_00382200 predicted 302
8 SASI_Rn02_00382201 predicted 419
9 SASI_Rn02_00382202 predicted 1042
10 SASI_Rn02_00382203 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_138975 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240651 predicted 1285
2 SASI_Mm01_00240653 predicted 1100
3 SASI_Mm01_00240654 predicted 1322
4 SASI_Mm01_00240655 predicted 1296
5 SASI_Mm02_00424846 predicted 1271
6 SASI_Mm01_00240656 predicted 1310
7 SASI_Mm02_00424847 predicted 965
8 SASI_Mm02_00424848 predicted 1168
9 SASI_Mm02_00424849 predicted 1229
10 SASI_Mm02_00424850 predicted 1115
11 SASI_Mm01_00240649 predicted 951
12 SASI_Mm01_00240650 predicted 1082
13 SASI_Mm01_00240652 predicted 1050
14 SASI_Mm01_00240657 predicted 948
15 SASI_Mm01_00240658 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435885 predicted 483
2 SASI_Mm02_00435886 predicted 1097
3 SASI_Mm02_00435887 predicted 601
4 SASI_Mm02_00435888 predicted 1323
5 SASI_Mm02_00435889 predicted 1296
6 SASI_Mm02_00435890 predicted 668
7 SASI_Mm02_00435891 predicted 1276
8 SASI_Mm02_00435892 predicted 1312
9 SASI_Mm02_00435893 predicted 428
10 SASI_Mm02_00435894 predicted 742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014696
GPRIN2 MISSION shRNA Bacterial Glycerol Stock
G protein regulated inducer of neurite outgrowth 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014696.3-1615s21c1
Sequence:CCGGGCACATCTCTCACCTGAATATCTCGAGATATTCAGGTGAGAGATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014696.2-1071s1c1
Sequence:CCGGGACCAAAGATGTGTGGACCATCTCGAGATGGTCCACACATCTTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014696.3-965s21c1
Sequence:CCGGAGATCCACTGTAGGTTGTCTGCTCGAGCAGACAACCTACAGTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014696.3-667s21c1
Sequence:CCGGCCTGAGGATGAGACTTCTAACCTCGAGGTTAGAAGTCTCATCCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014696.3-482s21c1
Sequence:CCGGCTATGCAGAGGAGCCATTCAGCTCGAGCTGAATGGCTCCTCTGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014696.2-1624s1c1
Sequence:CCGGGCACATGTCTCACCCGAATATCTCGAGATATTCGGGTGAGACATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014696.2-1717s1c1
Sequence:CCGGCTTGATTTCCAAGGGCCACATCTCGAGATGTGGCCCTTGGAAATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014696.3-1080s21c1
Sequence:CCGGCATGACCTCAGCCAATGACTTCTCGAGAAGTCATTGGCTGAGGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014696
GPRIN2 MISSION shRNA shRNA Plasmid DNA
G protein regulated inducer of neurite outgrowth 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014696.3-1615s21c1
Sequence:CCGGGCACATCTCTCACCTGAATATCTCGAGATATTCAGGTGAGAGATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014696.2-1071s1c1
Sequence:CCGGGACCAAAGATGTGTGGACCATCTCGAGATGGTCCACACATCTTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014696.3-965s21c1
Sequence:CCGGAGATCCACTGTAGGTTGTCTGCTCGAGCAGACAACCTACAGTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014696.3-667s21c1
Sequence:CCGGCCTGAGGATGAGACTTCTAACCTCGAGGTTAGAAGTCTCATCCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014696.3-482s21c1
Sequence:CCGGCTATGCAGAGGAGCCATTCAGCTCGAGCTGAATGGCTCCTCTGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014696.2-1624s1c1
Sequence:CCGGGCACATGTCTCACCCGAATATCTCGAGATATTCGGGTGAGACATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014696.2-1717s1c1
Sequence:CCGGCTTGATTTCCAAGGGCCACATCTCGAGATGTGGCCCTTGGAAATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014696.3-1080s21c1
Sequence:CCGGCATGACCTCAGCCAATGACTTCTCGAGAAGTCATTGGCTGAGGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014696
GPRIN2 MISSION shRNA Lentiviral Transduction Particles
G protein regulated inducer of neurite outgrowth 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244113    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014696.3-1615s21c1
Sequence:CCGGGCACATCTCTCACCTGAATATCTCGAGATATTCAGGTGAGAGATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014696.2-1071s1c1
Sequence:CCGGGACCAAAGATGTGTGGACCATCTCGAGATGGTCCACACATCTTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014696.3-965s21c1
Sequence:CCGGAGATCCACTGTAGGTTGTCTGCTCGAGCAGACAACCTACAGTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014696.3-667s21c1
Sequence:CCGGCCTGAGGATGAGACTTCTAACCTCGAGGTTAGAAGTCTCATCCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014696.3-482s21c1
Sequence:CCGGCTATGCAGAGGAGCCATTCAGCTCGAGCTGAATGGCTCCTCTGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180786    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014696.2-1624s1c1
Sequence:CCGGGCACATGTCTCACCCGAATATCTCGAGATATTCGGGTGAGACATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014696.2-1717s1c1
Sequence:CCGGCTTGATTTCCAAGGGCCACATCTCGAGATGTGGCCCTTGGAAATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014696.3-1080s21c1
Sequence:CCGGCATGACCTCAGCCAATGACTTCTCGAGAAGTCATTGGCTGAGGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_138975
GPRIN2 MISSION shRNA Bacterial Glycerol Stock
G protein regulated inducer of neurite outgrowth 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-1272s21c1
Sequence:CCGGCCTGAGACTCTGAACCTATTTCTCGAGAAATAGGTTCAGAGTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-509s21c1
Sequence:CCGGTACCATGGGCATCGGTGATCTCTCGAGAGATCACCGATGCCCATGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-572s21c1
Sequence:CCGGCCACTCAGACTTGGTACATAGCTCGAGCTATGTACCAAGTCTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-1024s21c1
Sequence:CCGGAGGCCCAGTGTGGGATGAAATCTCGAGATTTCATCCCACACTGGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-795s21c1
Sequence:CCGGTGGGTGCCAACCGTAGAACTACTCGAGTAGTTCTACGGTTGGCACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_138975
GPRIN2 MISSION shRNA shRNA Plasmid DNA
G protein regulated inducer of neurite outgrowth 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-1272s21c1
Sequence:CCGGCCTGAGACTCTGAACCTATTTCTCGAGAAATAGGTTCAGAGTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-509s21c1
Sequence:CCGGTACCATGGGCATCGGTGATCTCTCGAGAGATCACCGATGCCCATGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-572s21c1
Sequence:CCGGCCACTCAGACTTGGTACATAGCTCGAGCTATGTACCAAGTCTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-1024s21c1
Sequence:CCGGAGGCCCAGTGTGGGATGAAATCTCGAGATTTCATCCCACACTGGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-795s21c1
Sequence:CCGGTGGGTGCCAACCGTAGAACTACTCGAGTAGTTCTACGGTTGGCACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_138975
GPRIN2 MISSION shRNA Lentiviral Transduction Particles
G protein regulated inducer of neurite outgrowth 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-1272s21c1
Sequence:CCGGCCTGAGACTCTGAACCTATTTCTCGAGAAATAGGTTCAGAGTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-509s21c1
Sequence:CCGGTACCATGGGCATCGGTGATCTCTCGAGAGATCACCGATGCCCATGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-572s21c1
Sequence:CCGGCCACTCAGACTTGGTACATAGCTCGAGCTATGTACCAAGTCTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-1024s21c1
Sequence:CCGGAGGCCCAGTGTGGGATGAAATCTCGAGATTTCATCCCACACTGGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_138975.8-795s21c1
Sequence:CCGGTGGGTGCCAACCGTAGAACTACTCGAGTAGTTCTACGGTTGGCACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)