EMAIL THIS PAGE TO A FRIEND

GPRIN3

GPRIN family member 3

137 Gene Product Result for
Synonyms: GRIN3
UniProtKB ID: Q6ZVF9, Q8IVE4
Gene ID:
Mouse(243385) GPRIN family member 3
Rat(502784) GPRIN family member 3
chicken(428740) GPRIN family member 3
domestic cat(101092106) GPRIN family member 3
dog(487856) GPRIN family member 3
cow(517995) GPRIN family member 3
Horse(100064151) GPRIN family member 3
sheep(101117844) GPRIN family member 3
Domestic Rabbit(100344246) GPRIN family member 3
domestic guinea pig(100725105) GPRIN family member 3
naked mole-rat(101699330) GPRIN family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183183 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183183 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183183 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198281 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156441 MISSION® esiRNA esiRNA human GPRIN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198281 Rosetta Predictions human pricing
XM_578282 Rosetta Predictions rat pricing
XR_008204 Rosetta Predictions rat pricing
NM_183183 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237776 predicted 1382
2 SASI_Hs02_00371841 predicted 2216
3 SASI_Hs01_00237777 predicted 2853
4 SASI_Hs01_00237778 predicted 2236
5 SASI_Hs01_00237779 predicted 556
6 SASI_Hs01_00237780 predicted 632
7 SASI_Hs01_00237781 predicted 2341
8 SASI_Hs01_00237782 predicted 1289
9 SASI_Hs02_00371842 predicted 1839
10 SASI_Hs01_00237783 predicted 1213
11 SASI_Hs01_00237784 predicted 2369
12 SASI_Hs01_00237785 predicted 1837
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139778 predicted 504
2 SASI_Rn01_00139779 predicted 2119
3 SASI_Rn01_00139780 predicted 593
4 SASI_Rn01_00139781 predicted 1924
5 SASI_Rn01_00139782 predicted 1817
6 SASI_Rn01_00139783 predicted 407
7 SASI_Rn01_00139784 predicted 629
8 SASI_Rn01_00139785 predicted 2031
9 SASI_Rn01_00139786 predicted 1648
10 SASI_Rn01_00139787 predicted 1923
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141716 predicted 620
2 SASI_Rn01_00141718 predicted 1546
3 SASI_Rn01_00141719 predicted 961
4 SASI_Rn01_00141722 predicted 1154
5 SASI_Rn01_00141723 predicted 1508
6 SASI_Rn01_00141724 predicted 1417
7 SASI_Rn01_00141725 predicted 1131
8 SASI_Rn02_00416484 predicted 735
9 SASI_Rn02_00416485 predicted 1614
10 SASI_Rn02_00416486 predicted 849
11 SASI_Rn01_00141717 predicted 206
12 SASI_Rn01_00141720 predicted 1084
13 SASI_Rn01_00141721 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183183 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061346 predicted 2556
2 SASI_Mm01_00061348 predicted 1318
3 SASI_Mm01_00061349 predicted 2344
4 SASI_Mm01_00061350 predicted 637
5 SASI_Mm02_00350290 predicted 2408
6 SASI_Mm01_00061352 predicted 1572
7 SASI_Mm01_00061353 predicted 1077
8 SASI_Mm01_00061354 predicted 2556
9 SASI_Mm01_00061355 predicted 1574
10 SASI_Mm02_00350291 predicted 425
11 SASI_Mm01_00061347 predicted 597
12 SASI_Mm01_00061351 predicted 1895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183183
GPRIN3 MISSION shRNA Bacterial Glycerol Stock
GPRIN family member 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183183.1-1383s1c1
Sequence:CCGGGCATTGTACCACAGGTGCATACTCGAGTATGCACCTGTGGTACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183183.1-2568s1c1
Sequence:CCGGCCTTGTGTCTATTTGTGTCAACTCGAGTTGACACAAATAGACACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183183.1-881s1c1
Sequence:CCGGGAAGGGCAGAAAGTCATCAATCTCGAGATTGATGACTTTCTGCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183183.1-2648s1c1
Sequence:CCGGCCTAGGAGTAAACGCAACTATCTCGAGATAGTTGCGTTTACTCCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183183
GPRIN3 MISSION shRNA shRNA Plasmid DNA
GPRIN family member 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183183.1-1383s1c1
Sequence:CCGGGCATTGTACCACAGGTGCATACTCGAGTATGCACCTGTGGTACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183183.1-2568s1c1
Sequence:CCGGCCTTGTGTCTATTTGTGTCAACTCGAGTTGACACAAATAGACACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183183.1-881s1c1
Sequence:CCGGGAAGGGCAGAAAGTCATCAATCTCGAGATTGATGACTTTCTGCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183183.1-2648s1c1
Sequence:CCGGCCTAGGAGTAAACGCAACTATCTCGAGATAGTTGCGTTTACTCCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183183
GPRIN3 MISSION shRNA Lentiviral Transduction Particles
GPRIN family member 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183183.1-1383s1c1
Sequence:CCGGGCATTGTACCACAGGTGCATACTCGAGTATGCACCTGTGGTACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176525    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183183.1-2568s1c1
Sequence:CCGGCCTTGTGTCTATTTGTGTCAACTCGAGTTGACACAAATAGACACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183183.1-881s1c1
Sequence:CCGGGAAGGGCAGAAAGTCATCAATCTCGAGATTGATGACTTTCTGCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183183.1-2648s1c1
Sequence:CCGGCCTAGGAGTAAACGCAACTATCTCGAGATAGTTGCGTTTACTCCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198281
VALIDATED
GPRIN3 MISSION shRNA Bacterial Glycerol Stock
GPRIN family member 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_198281.1-1590s1c1
Sequence:CCGGGCCCAGCATACGTGTAAAGAACTCGAGTTCTTTACACGTATGCTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198281.1-2496s1c1
Sequence:CCGGCGGAGATCCATTTCCTCAGATCTCGAGATCTGAGGAAATGGATCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_198281.1-1726s1c1
Sequence:CCGGCATGCAGTCAAGCTGAAACAACTCGAGTTGTTTCAGCTTGACTGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198281.1-1816s1c1
Sequence:CCGGCAGACCCAGATTGCAAACTATCTCGAGATAGTTTGCAATCTGGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198281.1-2524s1c1
Sequence:CCGGCAAATAAGAAGCTCAGAGGAACTCGAGTTCCTCTGAGCTTCTTATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198281.1-1884s1c1
Sequence:CCGGGATCCCACTAATAAAGGAGATCTCGAGATCTCCTTTATTAGTGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_198281.1-2737s1c1
Sequence:CCGGGCGAGTATTCACTATAGGAAACTCGAGTTTCCTATAGTGAATACTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-1067s21c1
Sequence:CCGGATCAGGTGTCCTGTGAGTTTCCTCGAGGAAACTCACAGGACACCTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-2139s21c1
Sequence:CCGGTGCATCTCCTCAGGTAGTAAACTCGAGTTTACTACCTGAGGAGATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-2200s21c1
Sequence:CCGGACCCTACTGCTCAATCCTAAACTCGAGTTTAGGATTGAGCAGTAGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-2588s21c1
Sequence:CCGGGAATGACCTGGGAAGTGTATGCTCGAGCATACACTTCCCAGGTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-2638s21c1
Sequence:CCGGATCGCGATCCAGAACCATTTGCTCGAGCAAATGGTTCTGGATCGCGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198281
VALIDATED
GPRIN3 MISSION shRNA shRNA Plasmid DNA
GPRIN family member 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_198281.1-1590s1c1
Sequence:CCGGGCCCAGCATACGTGTAAAGAACTCGAGTTCTTTACACGTATGCTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198281.1-2496s1c1
Sequence:CCGGCGGAGATCCATTTCCTCAGATCTCGAGATCTGAGGAAATGGATCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_198281.1-1726s1c1
Sequence:CCGGCATGCAGTCAAGCTGAAACAACTCGAGTTGTTTCAGCTTGACTGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198281.1-1816s1c1
Sequence:CCGGCAGACCCAGATTGCAAACTATCTCGAGATAGTTTGCAATCTGGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198281.1-2524s1c1
Sequence:CCGGCAAATAAGAAGCTCAGAGGAACTCGAGTTCCTCTGAGCTTCTTATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198281.1-1884s1c1
Sequence:CCGGGATCCCACTAATAAAGGAGATCTCGAGATCTCCTTTATTAGTGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_198281.1-2737s1c1
Sequence:CCGGGCGAGTATTCACTATAGGAAACTCGAGTTTCCTATAGTGAATACTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-1067s21c1
Sequence:CCGGATCAGGTGTCCTGTGAGTTTCCTCGAGGAAACTCACAGGACACCTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-2139s21c1
Sequence:CCGGTGCATCTCCTCAGGTAGTAAACTCGAGTTTACTACCTGAGGAGATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-2200s21c1
Sequence:CCGGACCCTACTGCTCAATCCTAAACTCGAGTTTAGGATTGAGCAGTAGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-2588s21c1
Sequence:CCGGGAATGACCTGGGAAGTGTATGCTCGAGCATACACTTCCCAGGTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-2638s21c1
Sequence:CCGGATCGCGATCCAGAACCATTTGCTCGAGCAAATGGTTCTGGATCGCGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198281
VALIDATED
GPRIN3 MISSION shRNA Lentiviral Transduction Particles
GPRIN family member 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_198281.1-1590s1c1
Sequence:CCGGGCCCAGCATACGTGTAAAGAACTCGAGTTCTTTACACGTATGCTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198281.1-2496s1c1
Sequence:CCGGCGGAGATCCATTTCCTCAGATCTCGAGATCTGAGGAAATGGATCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_198281.1-1726s1c1
Sequence:CCGGCATGCAGTCAAGCTGAAACAACTCGAGTTGTTTCAGCTTGACTGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198281.1-1816s1c1
Sequence:CCGGCAGACCCAGATTGCAAACTATCTCGAGATAGTTTGCAATCTGGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198281.1-2524s1c1
Sequence:CCGGCAAATAAGAAGCTCAGAGGAACTCGAGTTCCTCTGAGCTTCTTATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198281.1-1884s1c1
Sequence:CCGGGATCCCACTAATAAAGGAGATCTCGAGATCTCCTTTATTAGTGGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129980    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_198281.1-2737s1c1
Sequence:CCGGGCGAGTATTCACTATAGGAAACTCGAGTTTCCTATAGTGAATACTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-1067s21c1
Sequence:CCGGATCAGGTGTCCTGTGAGTTTCCTCGAGGAAACTCACAGGACACCTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-2139s21c1
Sequence:CCGGTGCATCTCCTCAGGTAGTAAACTCGAGTTTACTACCTGAGGAGATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-2200s21c1
Sequence:CCGGACCCTACTGCTCAATCCTAAACTCGAGTTTAGGATTGAGCAGTAGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-2588s21c1
Sequence:CCGGGAATGACCTGGGAAGTGTATGCTCGAGCATACACTTCCCAGGTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198281.2-2638s21c1
Sequence:CCGGATCGCGATCCAGAACCATTTGCTCGAGCAAATGGTTCTGGATCGCGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)