EMAIL THIS PAGE TO A FRIEND

GRAP2

GRB2-related adaptor protein 2

180 Gene Product Result for
Synonyms: GADS GRAP-2 GRB2L GRBLG GRID GRPL GrbX Grf40 Mona P38
UniProtKB ID: O75791, O43726, Q9NRB7
Gene ID:
Human(9402) Summary: This gene encodes a member of the GRB2/Sem5/Drk family. This member is an adaptor-like protein involved in leukocyte-specific protein-tyrosine kinase signaling. Like its related family member, GRB2-related adaptor protein (GRAP), this protein contains an SH2 domain flanked by two SH3 domains. This protein interacts with other proteins, such as GRB2-associated binding protein 1 (GAB1) and the SLP-76 leukocyte protein (LCP2), through its SH3 domains. Transcript variants utilizing alternative polyA sites exist. [provided by RefSeq, Jul 2008]
Mouse(17444) GRB2-related adaptor protein 2
Rat(366962) GRB2-related adaptor protein 2
domestic guinea pig(100733134) GRB2-related adaptor protein 2
naked mole-rat(101722049) GRB2-related adaptor protein 2
sheep(101107589) GRB2-related adaptor protein 2
chicken(770756) GRB2-related adaptor protein 2
cow(522346) GRB2-related adaptor protein 2
domestic cat(101084554) GRB2-related adaptor protein 2
dog(481241) GRB2-related adaptor protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004810 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004810 Rosetta Predictions human pricing
NM_001034944 Rosetta Predictions rat pricing
NM_010815 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242910 predicted 584
2 SASI_Hs01_00242911 predicted 597
3 SASI_Hs01_00242912 predicted 1324
4 SASI_Hs01_00242913 predicted 390
5 SASI_Hs01_00242915 predicted 617
6 SASI_Hs01_00242916 predicted 535
7 SASI_Hs01_00242917 predicted 417
8 SASI_Hs01_00242918 predicted 542
9 SASI_Hs01_00242919 predicted 265
10 SASI_Hs02_00338354 predicted 307
11 SASI_Hs01_00242914 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034944 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120575 predicted 336
2 SASI_Rn01_00120576 predicted 451
3 SASI_Rn01_00120577 predicted 251
4 SASI_Rn01_00120578 predicted 347
5 SASI_Rn01_00120579 predicted 359
6 SASI_Rn01_00120580 predicted 651
7 SASI_Rn01_00120581 predicted 351
8 SASI_Rn01_00120582 predicted 872
9 SASI_Rn01_00120583 predicted 424
10 SASI_Rn01_00120584 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146201 predicted 380
2 SASI_Mm01_00146202 predicted 312
3 SASI_Mm01_00146203 predicted 379
4 SASI_Mm02_00319415 predicted 1177
5 SASI_Mm01_00146204 predicted 587
6 SASI_Mm01_00146205 predicted 899
7 SASI_Mm01_00146206 predicted 771
8 SASI_Mm01_00146207 predicted 608
9 SASI_Mm01_00146208 predicted 1530
10 SASI_Mm02_00319416 predicted 1349
11 SASI_Mm01_00146209 predicted 1351
12 SASI_Mm01_00146210 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004810
GRAP2 MISSION shRNA Bacterial Glycerol Stock
GRB2-related adaptor protein 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004810.2-397s21c1
Sequence:CCGGATGTGCCCAAGAATTTCATAGCTCGAGCTATGAAATTCTTGGGCACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004810.2-587s1c1
Sequence:CCGGGCGAGACAACAAGGGTAATTACTCGAGTAATTACCCTTGTTGTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004810.2-566s1c1
Sequence:CCGGCGTTCAACACTTCAAGGTCATCTCGAGATGACCTTGAAGTGTTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004810.2-635s1c1
Sequence:CCGGCCTAAATAAGCTGGTAGACTACTCGAGTAGTCTACCAGCTTATTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004810.2-963s21c1
Sequence:CCGGGGAGGCAGCCTTGACATAAATCTCGAGATTTATGTCAAGGCTGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004810.2-1363s1c1
Sequence:CCGGGCCTGTGTACACACACAACTTCTCGAGAAGTTGTGTGTGTACACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004810.2-316s1c1
Sequence:CCGGGCTTTCACACTGGAGATGTTTCTCGAGAAACATCTCCAGTGTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004810
GRAP2 MISSION shRNA shRNA Plasmid DNA
GRB2-related adaptor protein 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004810.2-397s21c1
Sequence:CCGGATGTGCCCAAGAATTTCATAGCTCGAGCTATGAAATTCTTGGGCACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004810.2-587s1c1
Sequence:CCGGGCGAGACAACAAGGGTAATTACTCGAGTAATTACCCTTGTTGTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004810.2-566s1c1
Sequence:CCGGCGTTCAACACTTCAAGGTCATCTCGAGATGACCTTGAAGTGTTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004810.2-635s1c1
Sequence:CCGGCCTAAATAAGCTGGTAGACTACTCGAGTAGTCTACCAGCTTATTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004810.2-963s21c1
Sequence:CCGGGGAGGCAGCCTTGACATAAATCTCGAGATTTATGTCAAGGCTGCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004810.2-1363s1c1
Sequence:CCGGGCCTGTGTACACACACAACTTCTCGAGAAGTTGTGTGTGTACACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000107179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004810.2-316s1c1
Sequence:CCGGGCTTTCACACTGGAGATGTTTCTCGAGAAACATCTCCAGTGTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004810
GRAP2 MISSION shRNA Lentiviral Transduction Particles
GRB2-related adaptor protein 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004810.2-397s21c1
Sequence:CCGGATGTGCCCAAGAATTTCATAGCTCGAGCTATGAAATTCTTGGGCACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004810.2-587s1c1
Sequence:CCGGGCGAGACAACAAGGGTAATTACTCGAGTAATTACCCTTGTTGTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004810.2-566s1c1
Sequence:CCGGCGTTCAACACTTCAAGGTCATCTCGAGATGACCTTGAAGTGTTGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004810.2-635s1c1
Sequence:CCGGCCTAAATAAGCTGGTAGACTACTCGAGTAGTCTACCAGCTTATTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004810.2-963s21c1
Sequence:CCGGGGAGGCAGCCTTGACATAAATCTCGAGATTTATGTCAAGGCTGCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004810.2-1363s1c1
Sequence:CCGGGCCTGTGTACACACACAACTTCTCGAGAAGTTGTGTGTGTACACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000107179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004810.2-316s1c1
Sequence:CCGGGCTTTCACACTGGAGATGTTTCTCGAGAAACATCTCCAGTGTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010815
GRAP2 MISSION shRNA Bacterial Glycerol Stock
GRB2-related adaptor protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010815.1-1723s1c1
Sequence:CCGGCGCCCTGAGAATTAAGGTGTACTCGAGTACACCTTAATTCTCAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010815.1-611s1c1
Sequence:CCGGCGAGAAGTTCCCATCCTTAAACTCGAGTTTAAGGATGGGAACTTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010815.1-610s1c1
Sequence:CCGGCCGAGAAGTTCCCATCCTTAACTCGAGTTAAGGATGGGAACTTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010815.1-376s1c1
Sequence:CCGGGCCAAGAAGGATATGTGCCTACTCGAGTAGGCACATATCCTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010815.1-1169s1c1
Sequence:CCGGGCACAACAAACTGGGTCTCTTCTCGAGAAGAGACCCAGTTTGTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010815
GRAP2 MISSION shRNA shRNA Plasmid DNA
GRB2-related adaptor protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010815.1-1723s1c1
Sequence:CCGGCGCCCTGAGAATTAAGGTGTACTCGAGTACACCTTAATTCTCAGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010815.1-611s1c1
Sequence:CCGGCGAGAAGTTCCCATCCTTAAACTCGAGTTTAAGGATGGGAACTTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010815.1-610s1c1
Sequence:CCGGCCGAGAAGTTCCCATCCTTAACTCGAGTTAAGGATGGGAACTTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010815.1-376s1c1
Sequence:CCGGGCCAAGAAGGATATGTGCCTACTCGAGTAGGCACATATCCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010815.1-1169s1c1
Sequence:CCGGGCACAACAAACTGGGTCTCTTCTCGAGAAGAGACCCAGTTTGTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010815
GRAP2 MISSION shRNA Lentiviral Transduction Particles
GRB2-related adaptor protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010815.1-1723s1c1
Sequence:CCGGCGCCCTGAGAATTAAGGTGTACTCGAGTACACCTTAATTCTCAGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010815.1-611s1c1
Sequence:CCGGCGAGAAGTTCCCATCCTTAAACTCGAGTTTAAGGATGGGAACTTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010815.1-610s1c1
Sequence:CCGGCCGAGAAGTTCCCATCCTTAACTCGAGTTAAGGATGGGAACTTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010815.1-376s1c1
Sequence:CCGGGCCAAGAAGGATATGTGCCTACTCGAGTAGGCACATATCCTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010815.1-1169s1c1
Sequence:CCGGGCACAACAAACTGGGTCTCTTCTCGAGAAGAGACCCAGTTTGTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)