EMAIL THIS PAGE TO A FRIEND

GRHL1

grainyhead-like 1 (Drosophila)

93 Gene Product Result for
Synonyms: LBP32 MGR NH32 TFCP2L2
Gene ID:
Human(29841) Summary: This gene encodes a member of the grainyhead family of transcription factors. The encoded protein can exist as a homodimer or can form heterodimers with sister-of-mammalian grainyhead or brother-of-mammalian grainyhead. This protein functions as a transcription factor during development. [provided by RefSeq, Jun 2009]
Mouse(195733) grainyhead-like 1 (Drosophila)
Rat(313993) grainyhead-like 1 (Drosophila)
Zebrafish(324942) grainyhead-like 1 (Drosophila)
domestic cat(101088233) grainyhead-like 1 (Drosophila)
cow(617248) grainyhead-like 1 (Drosophila)
Horse(100072465) grainyhead-like 1 (Drosophila)
dog(475664) grainyhead-like 1 (Drosophila)
chicken(428651) grainyhead-like 1 (Drosophila)
sheep(101103057) grainyhead-like 1 (Drosophila)
Domestic Rabbit(100352813) grainyhead-like 1 (Drosophila)
domestic guinea pig(100716038) grainyhead-like 1 (Drosophila)
naked mole-rat(101701372) grainyhead-like 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198182 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198182 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198182 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_014552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014552 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014552 Rosetta Predictions human pricing
NM_198182 Rosetta Predictions human pricing
XM_234006 Rosetta Predictions rat pricing
NM_145890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199726 predicted 1197
2 SASI_Hs01_00199727 predicted 1139
3 SASI_Hs01_00199728 predicted 1902
4 SASI_Hs01_00199729 predicted 1195
5 SASI_Hs01_00199730 predicted 1658
6 SASI_Hs01_00199731 predicted 1314
7 SASI_Hs01_00199732 predicted 1325
8 SASI_Hs01_00199733 predicted 2036
9 SASI_Hs02_00345815 predicted 1156
10 SASI_Hs02_00345816 predicted 1883
11 SASI_Hs01_00199724 predicted 1435
12 SASI_Hs01_00199725 predicted 1818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092880 predicted 580
2 SASI_Hs01_00092881 predicted 525
3 SASI_Hs01_00092882 predicted 1281
4 SASI_Hs01_00092883 predicted 578
5 SASI_Hs01_00092884 predicted 1049
6 SASI_Hs01_00092885 predicted 706
7 SASI_Hs01_00092886 predicted 714
8 SASI_Hs01_00092887 predicted 1417
9 SASI_Hs02_00371719 predicted 537
10 SASI_Hs02_00371720 predicted 1277
11 SASI_Hs01_00092878 predicted 815
12 SASI_Hs01_00092879 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388194 predicted 1579
2 SASI_Rn02_00388195 predicted 2322
3 SASI_Rn02_00388196 predicted 1755
4 SASI_Rn02_00388197 predicted 1752
5 SASI_Rn02_00388198 predicted 1337
6 SASI_Rn02_00388199 predicted 1434
7 SASI_Rn02_00388200 predicted 2098
8 SASI_Rn02_00388201 predicted 1986
9 SASI_Rn02_00388202 predicted 1324
10 SASI_Rn02_00388203 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042732 predicted 646
2 SASI_Mm01_00042733 predicted 1373
3 SASI_Mm01_00042734 predicted 499
4 SASI_Mm01_00042735 predicted 613
5 SASI_Mm01_00042736 predicted 590
6 SASI_Mm01_00042737 predicted 1351
7 SASI_Mm01_00042738 predicted 588
8 SASI_Mm01_00042739 predicted 604
9 SASI_Mm01_00042740 predicted 1529
10 SASI_Mm01_00042741 predicted 855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145890
GRHL1 MISSION shRNA Bacterial Glycerol Stock
grainyhead-like 1 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145890.2-497s21c1
Sequence:CCGGATTCAGAGGACTATGTCTTTGCTCGAGCAAAGACATAGTCCTCTGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145890.2-194s21c1
Sequence:CCGGATCTGACAGCTCCCGATACAACTCGAGTTGTATCGGGAGCTGTCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145890.1-1456s1c1
Sequence:CCGGGAGGCAATTTCAGACAAGTATCTCGAGATACTTGTCTGAAATTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145890.1-2074s1c1
Sequence:CCGGCCCTCAGCAATAAAGGGCTAACTCGAGTTAGCCCTTTATTGCTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145890.1-1545s1c1
Sequence:CCGGCGACAACATTGTGAAGCACTACTCGAGTAGTGCTTCACAATGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145890.1-1620s1c1
Sequence:CCGGGCTCACCCTGACAGAGATTTACTCGAGTAAATCTCTGTCAGGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145890.1-603s1c1
Sequence:CCGGCCTGAATAAAGGCCAGTTCTACTCGAGTAGAACTGGCCTTTATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145890.2-834s21c1
Sequence:CCGGCATTGAGGAGATAGCTTATAACTCGAGTTATAAGCTATCTCCTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145890
GRHL1 MISSION shRNA shRNA Plasmid DNA
grainyhead-like 1 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145890.2-497s21c1
Sequence:CCGGATTCAGAGGACTATGTCTTTGCTCGAGCAAAGACATAGTCCTCTGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145890.2-194s21c1
Sequence:CCGGATCTGACAGCTCCCGATACAACTCGAGTTGTATCGGGAGCTGTCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145890.1-1456s1c1
Sequence:CCGGGAGGCAATTTCAGACAAGTATCTCGAGATACTTGTCTGAAATTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145890.1-2074s1c1
Sequence:CCGGCCCTCAGCAATAAAGGGCTAACTCGAGTTAGCCCTTTATTGCTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145890.1-1545s1c1
Sequence:CCGGCGACAACATTGTGAAGCACTACTCGAGTAGTGCTTCACAATGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145890.1-1620s1c1
Sequence:CCGGGCTCACCCTGACAGAGATTTACTCGAGTAAATCTCTGTCAGGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145890.1-603s1c1
Sequence:CCGGCCTGAATAAAGGCCAGTTCTACTCGAGTAGAACTGGCCTTTATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145890.2-834s21c1
Sequence:CCGGCATTGAGGAGATAGCTTATAACTCGAGTTATAAGCTATCTCCTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145890
GRHL1 MISSION shRNA Lentiviral Transduction Particles
grainyhead-like 1 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145890.2-497s21c1
Sequence:CCGGATTCAGAGGACTATGTCTTTGCTCGAGCAAAGACATAGTCCTCTGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145890.2-194s21c1
Sequence:CCGGATCTGACAGCTCCCGATACAACTCGAGTTGTATCGGGAGCTGTCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145890.1-1456s1c1
Sequence:CCGGGAGGCAATTTCAGACAAGTATCTCGAGATACTTGTCTGAAATTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145890.1-2074s1c1
Sequence:CCGGCCCTCAGCAATAAAGGGCTAACTCGAGTTAGCCCTTTATTGCTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145890.1-1545s1c1
Sequence:CCGGCGACAACATTGTGAAGCACTACTCGAGTAGTGCTTCACAATGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145890.1-1620s1c1
Sequence:CCGGGCTCACCCTGACAGAGATTTACTCGAGTAAATCTCTGTCAGGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145890.1-603s1c1
Sequence:CCGGCCTGAATAAAGGCCAGTTCTACTCGAGTAGAACTGGCCTTTATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145890.2-834s21c1
Sequence:CCGGCATTGAGGAGATAGCTTATAACTCGAGTTATAAGCTATCTCCTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198182
GRHL1 MISSION shRNA Bacterial Glycerol Stock
grainyhead-like 1 (Drosophila)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198182.2-1221s21c1
Sequence:CCGGCATCGAGGAGATTGCGTATAACTCGAGTTATACGCAATCTCCTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198182.2-198s21c1
Sequence:CCGGGCCAGTGTTGGTTCTTCAGAACTCGAGTTCTGAAGAACCAACACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198182.2-2009s21c1
Sequence:CCGGTCACCCTGACGGAGATCTAAACTCGAGTTTAGATCTCCGTCAGGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198182.2-2180s21c1
Sequence:CCGGCTGGCTTGGTGGTAGCATTTACTCGAGTAAATGCTACCACCAAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198182.2-1821s21c1
Sequence:CCGGCCCATCTTTGAAGGGCTTGATCTCGAGATCAAGCCCTTCAAAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198182.2-2330s21c1
Sequence:CCGGGGACATCTGCTACGTTATTTACTCGAGTAAATAACGTAGCAGATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198182
GRHL1 MISSION shRNA shRNA Plasmid DNA
grainyhead-like 1 (Drosophila)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198182.2-1221s21c1
Sequence:CCGGCATCGAGGAGATTGCGTATAACTCGAGTTATACGCAATCTCCTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198182.2-198s21c1
Sequence:CCGGGCCAGTGTTGGTTCTTCAGAACTCGAGTTCTGAAGAACCAACACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198182.2-2009s21c1
Sequence:CCGGTCACCCTGACGGAGATCTAAACTCGAGTTTAGATCTCCGTCAGGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198182.2-2180s21c1
Sequence:CCGGCTGGCTTGGTGGTAGCATTTACTCGAGTAAATGCTACCACCAAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198182.2-1821s21c1
Sequence:CCGGCCCATCTTTGAAGGGCTTGATCTCGAGATCAAGCCCTTCAAAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198182.2-2330s21c1
Sequence:CCGGGGACATCTGCTACGTTATTTACTCGAGTAAATAACGTAGCAGATGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198182
GRHL1 MISSION shRNA Lentiviral Transduction Particles
grainyhead-like 1 (Drosophila)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198182.2-1221s21c1
Sequence:CCGGCATCGAGGAGATTGCGTATAACTCGAGTTATACGCAATCTCCTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198182.2-198s21c1
Sequence:CCGGGCCAGTGTTGGTTCTTCAGAACTCGAGTTCTGAAGAACCAACACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198182.2-2009s21c1
Sequence:CCGGTCACCCTGACGGAGATCTAAACTCGAGTTTAGATCTCCGTCAGGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369360    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198182.2-2180s21c1
Sequence:CCGGCTGGCTTGGTGGTAGCATTTACTCGAGTAAATGCTACCACCAAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198182.2-1821s21c1
Sequence:CCGGCCCATCTTTGAAGGGCTTGATCTCGAGATCAAGCCCTTCAAAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198182.2-2330s21c1
Sequence:CCGGGGACATCTGCTACGTTATTTACTCGAGTAAATAACGTAGCAGATGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014552
GRHL1 MISSION shRNA Bacterial Glycerol Stock
grainyhead-like 1 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-168s1c1
Sequence:CCGGGCCAGTGTTGGTTCTTCAGAACTCGAGTTCTGAAGAACCAACACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-493s1c1
Sequence:CCGGGTGCCATTTAACATTGTCCTTCTCGAGAAGGACAATGTTAAATGGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-1145s1c1
Sequence:CCGGGCATTGACATAGCTGACTATACTCGAGTATAGTCAGCTATGTCAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-1315s1c1
Sequence:CCGGCCTCTTAACATTCAAGTTGATCTCGAGATCAACTTGAATGTTAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-1791s1c1
Sequence:CCGGCCCATCTTTGAAGGGCTTGATCTCGAGATCAAGCCCTTCAAAGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014552
GRHL1 MISSION shRNA shRNA Plasmid DNA
grainyhead-like 1 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-168s1c1
Sequence:CCGGGCCAGTGTTGGTTCTTCAGAACTCGAGTTCTGAAGAACCAACACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-493s1c1
Sequence:CCGGGTGCCATTTAACATTGTCCTTCTCGAGAAGGACAATGTTAAATGGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-1145s1c1
Sequence:CCGGGCATTGACATAGCTGACTATACTCGAGTATAGTCAGCTATGTCAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-1315s1c1
Sequence:CCGGCCTCTTAACATTCAAGTTGATCTCGAGATCAACTTGAATGTTAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-1791s1c1
Sequence:CCGGCCCATCTTTGAAGGGCTTGATCTCGAGATCAAGCCCTTCAAAGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014552
GRHL1 MISSION shRNA Lentiviral Transduction Particles
grainyhead-like 1 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-168s1c1
Sequence:CCGGGCCAGTGTTGGTTCTTCAGAACTCGAGTTCTGAAGAACCAACACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-493s1c1
Sequence:CCGGGTGCCATTTAACATTGTCCTTCTCGAGAAGGACAATGTTAAATGGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-1145s1c1
Sequence:CCGGGCATTGACATAGCTGACTATACTCGAGTATAGTCAGCTATGTCAATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-1315s1c1
Sequence:CCGGCCTCTTAACATTCAAGTTGATCTCGAGATCAACTTGAATGTTAAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014552.2-1791s1c1
Sequence:CCGGCCCATCTTTGAAGGGCTTGATCTCGAGATCAAGCCCTTCAAAGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)